Council Of Scientific And Industrial Research - Delhi

31129444 supply of goods supply of goods , supply of the following material: , fetal bovine serum ( fbs ) , qualified, brazil , antibiotic antimycotic ( 100x ) , supersignal west pico plus chemiluminescent substrate , anti mir inhibitor , anti mirtm mirna inhibitor negative control , mirna mimics & inhibitors , high capacity cdna reverse transcripition kit with rnase inhibitor , opti memtm i reduced serum medium, no phenol red , pbs ( 10x ) , ph 7.4 , prolongtm diamond antifade mountant with dapi , yeast mitochondrial stain sampler kit , taqman adv microrna cdna syn , nalgenetm sterile syringe filters , stemprotm msc sfm xenofree...

Department Of Training And Technical Education - Delhi

30483118 bids are invited for aluminium foil, 18 microns thick aluminium foilbacteria resistant / disposable, 1 kg aluminium foil, 18 microns thick aluminium foilbacteria resistant / disposable, 1 kg , aspitator bottle with stop cock, medical grade pp , class vi , autoclavable 20 l, aspitator bottle with stop cock, medical grade pp , class vi , autoclavable 20 l, , biohazard bags, pp, autoclavable, 12x24, pack of 100 biohazard bags, pp, autoclavable, 12x24, pack of 100 , carboy with stop cock, medical grade pp , class vi, 20 l, pack of 1 carboy with stop cock, medical grade pp , class vi, 20 l, pack of 1 , cotton absorbent, pack of 500 gm cotton absorbent, pack of 500 gm , cotton non absorbent, pack of 500 gm cotton non absorbent, pack of 500 gm , cover slip, glass, 22x22 mm, square shape, box of 50 small packet, price per packet cover slip, glass, 22x22 mm, square shape, box of 50 small packet, price per packet , dettol original bar soap, 75 gm, dettol original bar soap, 75 gm, , dispenser for multi purpose labelling tape size 0.75x 500, dispenser for multi purpose labelling tape size 0.75x 500, , draining tray 400x300x100 mm, pack of 6 pcs draining tray 400x300x100 mm, pack of 6 pcs , dura seal stretch film, 4”x250’, roll, transparent polyethylene based, solvent resistant dura seal stretch film, 4”x250’, roll, transparent polyethylene based, solvent resistant , forecep, stainless steel forecep, stainless steel , glass slides, 76x26x1 mm, 50 packets per box, price per packet glass slides, 76x26x1 mm, 50 packets per box, price per packet , glass rod in pieces, 12”, in pcs glass rod in pieces, 12”, in pcs , hand protector grip, silicone, pack of 1 hand protector grip, silicone, pack of 1 , handypette pipette aid, pp silicon , capacity 10 ml, pack of 4 handypette pipette aid, pp silicon , capacity 10 ml, pack of 4 , handypette pipette aid, pp silicon , capacity 25 ml, pack of 4 handypette pipette aid, pp silicon , capacity 25 ml, pack of 4 , ice bucket, pcautoclavable, 2.5 l , pack of 01 ice bucket, pcautoclavable, 2.5 l , pack of 01 , incubation tray, rpp, autoclavable, 55x14mm, pack of 4 incubation tray, rpp, autoclavable, 55x14mm, pack of 4 , indicator tape for autoclave, 1”x500”, roll indicator tape for autoclave, 1”x500”, roll , inoculation needle, pouch of 20, pack of 100 inoculation needle, pouch of 20, pack of 100 , l molds: embedding moulds, 50x25x15 mm pair l molds: embedding moulds, 50x25x15 mm pair , l molds: embedding moulds, 75x30x19 mm pair l molds: embedding moulds, 75x30x19 mm pair , lubrication oil ( machine oil ) , 100ml lubrication oil ( machine oil ) , 100ml , measuring scoop, pp, 10 g, pack of 12 measuring scoop, pp, 10 g, pack of 12 , measuring scoop, pp, 5 g, pack of 12 measuring scoop, pp, 5 g, pack of 12 , membrane filter circular, 25 mm, for syringe filter, pore size < 0.45 μm, pkt of 100 disc membrane filter circular, 25 mm, for syringe filter, pore size < 0.45 μm, pkt of 100 disc , microshield handwash, 500 ml microshield handwash, 500 ml , microtom knife, a.o spencer type, size: 120mm microtom knife, a.o spencer type, size: 120mm , microtom knife, a.o spencer type, size: 160 mm microtom knife, a.o spencer type, size: 160 mm , multi purpose labelling tape, 0.75x 500, pack of 1 roll. multi purpose labelling tape, 0.75x 500, pack of 1 roll. , parafilm dispenser, pack of 1 parafilm dispenser, pack of 1 , parafilm roll, 4”x125’, pack of 1 parafilm roll, 4”x125’, pack of 1 , ph indicator paper, range:0 14, pack of 10 ph indicator paper, range:0 14, pack of 10 , polygon magnetic stirring bar, ptfe / alnico magnet, 8x22 mm, pack of 10 pc polygon magnetic stirring bar, ptfe / alnico magnet, 8x22 mm, pack of 10 pc , polygon magnetic stirring bar, ptfe / alnico magnet, 8x50 mm , pack of 10 pc polygon magnetic stirring bar, ptfe / alnico magnet, 8x50 mm , pack of 10 pc , rack for petridish pmma / pc, 60 places, 90mm, pack of 2 rack for petridish pmma / pc, 60 places, 90mm, pack of 2 , safeskin purple nitrile gloves 12 length, medium, pack of 50 pcs safeskin purple nitrile gloves 12 length, medium, pack of 50 pcs , safeskin purple nitrile gloves 12 length, large, pack of 50 pcs safeskin purple nitrile gloves 12 length, large, pack of 50 pcs , sterile cotton swab in screw capped polypropylene tube, cotton bud with polypropylene stick, size 75 mmx12mm dia tube individual box of 100 pcs sterile cotton swab in screw capped polypropylene tube, cotton bud with polypropylene stick, size 75 mmx12mm dia tube individual box of 100 pcs , syringes 10 ml, disposable, pack of 50 pcs syringes 10 ml, disposable, pack of 50 pcs , syringes 2 ml, disposable, pack of 100 pcs syringes 2 ml, disposable, pack of 100 pcs , syringes 5 ml, disposable, pack of 100 pcs syringes 5 ml, disposable, pack of 100 pcs , test tube cleaningbrush small test tube cleaningbrush small , test tube cleaningbrush large test tube cleaningbrush large , tips capacity 0.2 – 10 μl, pp, box of 1000 pc, price per pack tips capacity 0.2 – 10 μl, pp, box of 1000 pc, price per pack , tips capacity 20 – 1000 μl, pp, box of 500 pc, price per pack tips capacity 20 – 1000 μl, pp, box of 500 pc, price per pack , tips capacity 200 – 1000 μl, pp, box of 500 pc, price per pack tips capacity 200 – 1000 μl, pp, box of 500 pc, price per pack , tisue block holder for histopathology, set of 12 pcs tisue block holder for histopathology, set of 12 pcs , tissue paper roll, 100 mtr tissue paper roll, 100 mtr , universal reagent reservoir, pp, autoclavable, 50 ml, pack of 6 pcs, price per pack universal reagent reservoir, pp, autoclavable, 50 ml, pack of 6 pcs, price per pack , utility carrier 380x240x115mm, pp, autoclavable, pack of 02 utility carrier 380x240x115mm, pp, autoclavable, pack of 02 , vetro clean, laboratory glassware cleaning agent, 500 ml, pack of 6 bottles vetro clean, laboratory glassware cleaning agent, 500 ml, pack of 6 bottles , wintrobe tubes: 11 cm long, borosilicate cylindrical glass tube uniform bore with diameter of 2 mm lower end is closed wintrobe tubes: 11 cm long, borosilicate cylindrical glass tube uniform bore with diameter of 2 mm lower end is closed and flat tube is calibrated in cm & mm from 0 to 10 , white paper tissue roll white paper tissue roll , savlon 750ml savlon 750ml , dettolhand wash 750 ml dettolhand wash 750 ml , laboratory spatulas ( stainless steel, plastic , wooden ) : ( size:zmicro, mini, small ) ( shape: tapered end, blund end ) laboratory spatulas ( stainless steel, plastic , wooden ) : ( size:zmicro, mini, small ) ( shape: tapered end, blund end ) , syringe butterfly ( gauze:23, 24, 25, 25 & 26 ) pack 0f 100 pcs syringe butterfly ( gauze:23, 24, 25, 25 & 26 ) pack 0f 100 pcs , gloves ( latex, vinyl & nitrile ) , disposable powdered hand gloves, size l, pack of 20 gloves ( latex, vinyl & nitrile ) , disposable powdered hand gloves, size l, pack of 20 , test tube racks ( stainless steel, polygrid, polycarbonate ) 50 holes test tube racks ( stainless steel, polygrid, polycarbonate ) 50 holes , nichrome loop, 11 inches 10 pcs per pack nichrome loop, 11 inches 10 pcs per pack , first aid box ( bandage, antibiotic&antiseptic, thermometer, elastic bandages, dettol, cold pack, gauze roll & pads, adhesive tape, pain killer, cotton, scissor ) first aid box ( bandage, antibiotic&antiseptic, thermometer, elastic bandages, dettol, cold pack, gauze roll & pads, adhesive tape, pain killer, cotton, scissor ) , scissors for laboratory uses scissors for laboratory uses , face shield ( plasatic visor, transparent non flammabale ) face shield ( plasatic visor, transparent non flammabale ) , hand towel ( forlaboratory uses ) hand towel ( forlaboratory uses ) , spill kits ( hand gloves, face cover sheet, absorbent pad, bin with lid, plastic bags, hypochlorite ) spill kits ( hand gloves, face cover sheet, absorbent pad, bin with lid, plastic bags, hypochlorite ) , glass rods ( 150 x 6 mm ) pack of 12 glass rods ( 150 x 6 mm ) pack of 12 , dropper ( plastic ) 1 pack of 8 set dropper ( plastic ) 1 pack of 8 set , dropping bottle ( low densitypolyethylene, 250 ml dropping bottle ( low densitypolyethylene, 250 ml , asbestos gloves ( soft and comfortable 9.5inch asbestos gloves ( soft and comfortable 9.5inch , acid cart trolley ( carrying upto 150 kg of cargo, large platform, with rollings wheels ) acid cart trolley ( carrying upto 150 kg of cargo, large platform, with rollings wheels ) , digital clock ( loud, alarm, with magneticstand ) digital clock ( loud, alarm, with magneticstand ) , stop watch stop watch , glass capillaries ( borosilicate glass capaillaries 90 mm ) 1 pack of 100 pcs glass capillaries ( borosilicate glass capaillaries 90 mm ) 1 pack of 100 pcs , lamp spirit ( adjustable aluminium spirite lamp ) lamp spirit ( adjustable aluminium spirite lamp ) , glass rod: 6 inches long, borosilicate glass glass rod: 6 inches long, borosilicate glass , glass slides : microscope glass slides 75 x 25 x 1.4 mm ( 50 piece per box ) glass slides : microscope glass slides 75 x 25 x 1.4 mm ( 50 piece per box ) , test tube : borosil glass, 15 ml capacity test tube : borosil glass, 15 ml capacity , westergren tube: 300 mm long glass pipette calibrated in cm & mm from 0 to 200 from above to downwards in its lower two third bore diameter of 2.5mm lower mark is 180mm it’s both ends are open westergren tube: 300 mm long glass pipette calibrated in cm & mm from 0 to 200 from above to downwards in its lower two third bore diameter of 2.5mm lower mark is 180mm it’s both ends are open , stethoscope: stainless steel plated chest piece with special diaphragm, compact with dual frequencyseamless pvc tubing, brass chrome plated open spring frame, soft ear knobs with best sound quality stethoscope: stainless steel plated chest piece with special diaphragm, compact with dual frequencyseamless pvc tubing, brass chrome plated open spring frame, soft ear knobs with best sound quality , abdominal belt: abdominal belt ( m ) abdominal belt: abdominal belt ( m ) , absorbent cotton wool: 8 millimeter thick 25 millimeter wide absorbent cotton wool: 8 millimeter thick 25 millimeter wide , adult catheter without baloon: 100% latex with silicon size ( fg ) 12 adult catheter without baloon: 100% latex with silicon size ( fg ) 12 , adult two way foley balloon catheter: 100% silicon balloon capacity ( ml ) 15 adult two way foley balloon catheter: 100% silicon balloon capacity ( ml ) 15 , buchner funnel: porcelain, 3 buchner funnel: porcelain, 3 , butter paper sheet: for lab use butter paper sheet: for lab use , capillary tubes: glass tube size: 0. 30mm id to 10. 00mm od capillary tubes: glass tube size: 0. 30mm id to 10. 00mm od , china dish : size 80x45mm, porcelain china dish : size 80x45mm, porcelain , colostomy bags: pvc hole diameter ( mm ) 50 colostomy bags: pvc hole diameter ( mm ) 50 , cotton crepe bandage:4 meter x 8 centimeter ( lxw ) cotton crepe bandage:4 meter x 8 centimeter ( lxw ) , digital thermometer: accuracy 0.5 degree celcius digital thermometer: accuracy 0.5 degree celcius , filter paper 237 grade blotter paper: 237 grade blotter paper, for lab use filter paper 237 grade blotter paper: 237 grade blotter paper, for lab use , genaxy grade 2 ( usually chemically resist ) neutral glass multipurpose test tubes genaxyr genaxy grade 2 ( usually chemically resist ) neutral glass multipurpose test tubes genaxyr , ispaghula: herbal drug seeds ispaghula: herbal drug seeds , iv set transfusion set: for  single use iv set transfusion set: for  single use , knee cap: large size knee cap: large size , lancet: material: stainless steel needle moulded in plastic strip type disposable needle plastic mould size: medium lancet: material: stainless steel needle moulded in plastic strip type disposable needle plastic mould size: medium , lumbo sacchral support ls belt: large size lumbo sacchral support ls belt: large size , micrometer slide eyepiece: size: 19mm round, 10 mm linear scale micrometer slide eyepiece: size: 19mm round, 10 mm linear scale , mortar & pestle porcelain: porcelain, 4 mortar & pestle porcelain: porcelain, 4 , needle : 24 nos syringe needle needle : 24 nos syringe needle , needle sheath disposable hypodermic needle 22 mm needle sheath disposable hypodermic needle 22 mm , needle sheath disposable hypodermic needle 25 mm needle sheath disposable hypodermic needle 25 mm , nutmeg : herbal drugs seeds nutmeg : herbal drugs seeds , oxygen masks: pvc size 2 3cm oxygen masks: pvc size 2 3cm , peadiatric two way foley balloon catheter: balloon capacity ( 25ml ) peadiatric two way foley balloon catheter: balloon capacity ( 25ml ) , peak flow meter: impact resistant polycarbonateweight of the instrument ( gms ) 60 to 70material of mouth piece peak flow meter: impact resistant polycarbonateweight of the instrument ( gms ) 60 to 70material of mouth piece high density polyethyleneusage of mouth piece single usemouth piece length ( mm ) 64mouth piece outer dia ( mm ) 22 , plaster of paris bandage: 15 cm plaster of paris bandage: 15 cm , plastic walking stick: type of handle ergonomicmaterial of handle plastic plastic walking stick: type of handle ergonomicmaterial of handle plastic , pulse oximeter: low battery indicator, alarm function and automatic power off in 8 seconds pulse oximeter: low battery indicator, alarm function and automatic power off in 8 seconds , punernava : herbal drug leaf punernava : herbal drug leaf , pure white sterile gauze pads or swabs: single use disposable cotton pure white sterile gauze pads or swabs: single use disposable cotton , ryle’s tube: nutritional feeding pvc ryle’s tube: nutritional feeding pvc , stalagmometer: borosilicate glass stalagmometer: borosilicate glass , test tube cleaning brush: nylon brush, diameter of brush: 12mm, length of brush: 100mm, overall length: 220mm test tube cleaning brush: nylon brush, diameter of brush: 12mm, length of brush: 100mm, overall length: 220mm , thoracic drainage catheter ( chest drainage catheter ) : 40cm thoracic drainage catheter ( chest drainage catheter ) : 40cm , urine bag: type of outlet push pull type capacity of bag ( ml ) 2000 milliliter urine bag: type of outlet push pull type capacity of bag ( ml ) 2000 milliliter , urine pots: pvc / plastic urine pots: pvc / plastic total quantity : 1...

G B Pant Hospital - Delhi

29456986 e tender for procurement of consumables glasswares and miscellaneous items in microbiology department, gipmer, new delhi , acid proof gloves ( pair ) large size upto elbow , aluminium caps wih rubber washer small , aluminium caps with rubber washer big , aluminium foil , antibiotic zone scale , autoclave tape , blotting paper sheet , brown packing tape , brown paper thick , brown paper thin , bottle brush big , bottle brush small , conical flask 100 ml corning / ( borosil ) , conical flask corning / borosil 1000 ml , conical flask corning / borosil 250 ml , conical flask corning / borosil 500 ml , cover slip ( 22x22mm ) , diamond glass marking pencil , disc dispenser 6 position , durhams tubes , elisa plate – medium binding, detachable 96 wells , eppendorf tube 2 ml , falcon tube 15 ml , falcon tube 50 ml , filter paper sheet , flat bottom roun flask 100 mi , flat bottom round flask 1000 ml , flat bottom round flask 2000 ml , flat bottom round flask 250 ml , flat bottom round flask 500 ml , glass beaker ( borosil ) , glass beaker ( borosil ) , glass beaker ( borosil ) , glass funnel 6 , glass funnel=12 , glass funnel =8 , glass funnel =10 , glass marking pen , glass marking pencil , glass measuring cylinder 100 ml , glass slides micobiology ( 76x25mm ) , glass vials with rubber cork for lypholyzer 10 ml , glass vials with rubber cork for lypholyzer 5 ml , glass beaker ( borosil ) 500ml , conical flask ( o ring ) 5 litre , laboratory thermometer , laboratory tray with cover stainless steel , mac cartney bottle for blood culture with aluminium screw cap with rubber liner capacity 30 ml , mac cartney bottle for blood culture with aluminium screw cap with rubber liner capacity 100 ml , mac cartney bottle for blood culture with aluminium screw cap with rubber liner capacity 150 ml , micropipettes variable volume. , micropipettes variable volume. , micropipettes variable volume. , microtipstand blue , microtipstand yellow , millipore syringe filter ( 22 micron ) , nichrome loop diameter 4 mm, double wound, calibrated 100 0.01 ml , nichrome wire straight , parafilm , pestle mortar , ph paper , ph paper , plasticin , polysterene tube with screw cap , test tube rack for tubes, 4 inch, for 36 tubes , test tube rack for tubes, 5 inch, for 36 tubes , test tube rack for tubes, 6 inch, for 36 tubes , rubber washer ( mac cartney bottle ) , sietz filter paper , slide tray aluminium , spirit lamp , sterile urine culture bottle ( 20 ml ) , sterile petridishes 10 cm ( disposable ) , teepol , test tube ( borosil ) , test tube ( borosil ) , test tube stand , test tube stand plastic , thread for use in media room , thumb press dispensing dropper / pateur pipette plastic ( semi transparent ) , thumb press dispensing dropper / pateur pipette plastic ( semi transparent ) , tips for micropipette 100 micro litre , tips for micropipette 1000 micro litre , whatmann filter paper sheets round , wire basket big , wire basket small , wire gauze , polysterene tube with screw cap conical bottom graduate leakproof autoclavable 15 ml , polysterene tube with screw cap conical bottom graduate leakproof autoclavable 50 ml , aliquot vial with o ring attached hinged screw cap conical bottom, autoclavable dnase / rnase free 1.5 2 ml , test tube stand ( aluminium ) , pipette holder stand , anaerobic jar , vdrl glass slide...

Maulana Azad Medical College - Delhi

25091494 supply of consumables kits and chemicals form mru lab 1. dna ( from blood ) isolation kit 2. pcr master mix 3. agarose ( molecular garde ) 4. nuclease free water ( for dna / rna dilution ) 5. dna ladder 100bp 6. dna ladder 20bp 7. 6x gel loading dye ( for dna / rna agarose gel electrophoresis ) 8. tae buffer ( for dna / rna agarose gel electrophoresis ) 9. tbe buffer ( for dna agarose gel electrophoresis ) 10. micro centrifuge tube ( 1.5ml ) ( for dna / rna work ) plastic. 11. micro pipette tips ( 1ml ) ( for dna / rna work ) 12. micro pipette tips ( 200μl ) ( for dna / rna work ) 13. micro pipette tips ( 10μl ) ( for dna / rna work ) 14. drug: acton prolongatum 15. dapi counterstain 16. np40 buffer 17. ssc buffer 18. kcl ( molecular grade ) 19. ethanol ( molecular biology grade ) 20. restriction enzymes bsrdi, 21. bsai, 22. hae ii, 23. bst eii, 24. bst ui, 25. xmni 26. spf column for organochlorine extraction from serum for measurement by gcms 27. oligonucleotide primers for pcr 28. rna ( from tissue ) isolation kit ( manual ) 29. cdna synthesis kit 30. sybr green master mix 31. thyrotropic hormone from human pituitary 32. cell culture media rpmi1640 ( with stable glutamine ) 33. fbs ( us origin ) for cell culture 34. antibiotic + antimycotic solution for cell culture 35. dmso solution for cell culture 36. cryovials ( 2 ml ) 37. human tgf beta elisa kit 38. rabbit monoclonal to stat3 ( phospho y705 ) antibody reactivity human, dilution 1:1000 39. human il 6 elisa kit 40. 1, 2 dimethylhydrazine ( dmh ) analytical grade, 10g vial 41. 5 flurouracil analytical grade, 100mg 42. rat beta glucosidase elisa kit, 96wells 43. rat beta glucuronidase elisa kit, 96wells 44. rat carcinoembryonic antign elisa kit 45. rat cancer antigen 19 9 elisa kit, 96wells 46. rat p53 / tumor protein elisa kit, 96wells 47. human v ki ras2 kirsten rat sarcoma viral oncogene homlog elisa kit, , 96wells 48. 23 g x 0.75 in needle x 7 in tubing bd safety lok™ blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle200 / pk 49. xylene liquid, glass bottle 2liter / pk ( analytical grade ) 50. inj. thiopental sodium 1gm / pk 51. tuberculin syringe with needle 100 / pk 52. micro tube with locking cap, 2ml capacity cone bottom 500 / pk 53. cell culture plate 96 wells ( sterile pack ) 54. cell culture plate 12 wells ( sterile pack ) 55. cell culture plate 6 wells ( sterile pack ) 56. cell culture flask t25 ( sterile pack ) 57. cell culture flask t75 ( sterile pack ) 58. powder free nitrile gloves ( medium size ) 59. powder free nitrile gloves ( large size ) 60. autoclavable glass bottles 500 ml ( blue capped ) 61. autoclavable glass bottles 250 ml ( blue capped ) 62. autoclavable glass bottles 1000 ml ( blue capped ) 63. conical flask 250 ml 64. conical flask 100 ml 65. haemocytometer for cell counting 66. trypan blue solution for cell counting ( 0.2% ) 67. falcon tubes ( 15 ml ) for cell culture work. 68. falcon tubes for cell culture work ( 50 ml ) 69. serological sterile pipette for cell culture ( 10 ml ) 70. serological sterile pipette for cell culture ( 5 ml ) 71. syringe filter pvdf, 33mm, 0.22 micron 72. glass slides ( 1.10mm, 75x25mm ) 73. cover slip square ( square shapes ) size 22 mm × 22 mm 74. human exome sequencing by ngs...

Maulana Azad Medical College - Delhi

23962871 supply of consumables / kits: 1. dna ( from blood ) isolation kit 2. pcr master mix 3. agarose ( molecular garde ) 4. nuclease free water ( for dna / rna dilution ) 5. dna ladder 100bp 6. dna ladder 20bp 7. 6x gel loading dye ( for dna / rna agarose gel electrophoresis ) 8. tae buffer ( for dna / rna agarose gel electrophoresis ) 9. tbe buffer ( for dna agarose gel electrophoresis ) 10. serum cortisol kit 11. micro centrifuge tube ( 1.5ml ) ( for dna / rna work ) plastic. 12. micro pipette tips ( 1ml ) ( for dna / rna work ) 13. micro pipette tips ( 200μl ) ( for dna / rna work ) 14. micro pipette tips ( 10μl ) ( for dna / rna work ) 15. pcr tubes ( flat cap clear 0.25ml ) 16. pcr tubes ( flat cap clear 0.5ml ) 17. drug: acton prolongatum 18. dapi counterstain 19. np40 buffer 20. ssc buffer 21. kcl ( molecular grade ) 22. ethanol ( molecular biology grade ) 23. restriction enzymes bsrdi, bsai, hae ii, bst eii, bst ui, xmni 24. spf column for organochlorine extraction from serum for measurement by gcms 25. oligonucleotide primers for pcr ( rs20 / base ) 26. rna ( from tissue ) isolation kit ( 50% for automatic and 50% for manual ) 27. cdna synthesis kit 28. sybr green master mix 29. thyrotropic hormone from human pituitary 30. cell culture media rpmi1640 ( with stable glutamine ) 31. fbs ( us origin ) for cell culture 32. antibiotic + antimycotic solution for cell culture 33. dmso solution for cell culture 34. cryovials ( 2 ml ) 35. human tgf beta elisa kit 36. rabbit monoclonal to stat3 ( phospho y705 ) antibody reactivity human, dilution 1:1000 37. human il 6 elisa kit 38. delfia victor 2d hafp kit ( perkin elmer india, proprietary item ) 39. 1, 2 dimethylhydrazine ( dmh ) analytical grade, 10g vial 40. 5 flurouracil analytical grade, 100mg 41. rat beta glucosidase elisa kit, 96wells 42. rat beta glucuronidase elisa kit, 96wells 43. rat carcinoembryonic antign elisa kit 44. rat cancer antigen 19 9 elisa kit, 96wells 45. rat p53 / tumor protein elisa kit, 96wells 46. human v ki ras2 kirsten rat sarcoma viral oncogene homlog elisa kit, , 96wells 47. 23 g x 0.75 in needle x 7 in tubing bd safety lok™ blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle200 / pk 48. xylene liquid, glass bottle 2liter / pk ( analytical grade ) 49. inj. thiopental sodium 1gm / pk 50. tuberculin syringe with needle 100 / pk 51. micro tube with locking cap, 2ml capacity cone bottom 500 / pk 52. neem ( azadirachta indica ) leaf extract, 60 tab / vial, 250mg. 53. cell culture plate 96 wells ( sterile pack ) 54. cell culture plate 12 wells ( sterile pack ) 55. cell culture plate 6 wells ( sterile pack ) 56. cell culture flask t25 ( sterile pack ) 57. cell culture flask t75 ( sterile pack ) 58. powder free nitrile gloves ( medium size ) 59. powder free nitrile gloves ( large size ) 60. autoclavable glass bottles 500 ml 61. autoclavable glass bottles 250 ml 62. autoclavable glass bottles 1000 ml 63. conical flask 250 ml 64. conical flask 100 ml 65. haemocytometer for cell counting 66. trypan blue solution for cell counting ( 0.2% ) 67. falcon tubes ( 15 ml ) for cell culture work. 68. falcon tubes for cell culture work ( 50 ml ) 69. serological sterile pipette for cell culture ( 10 ml ) 70. serological sterile pipette for cell culture ( 5 ml ) 71. syringe filter pvdf, 33mm, 0.22 micron 72. glass slides ( 1.10mm, 75x25mm ) 73. cover slip square ( square shapes ) 74. sequencing...

Indian Council Of Medical Research - Delhi

23039417 quotation for supply of laboratory chemicals/ monoclonal antibodies/ kits/ primers/ lab plasticware, etc. richcore product recombinant trypsin ) a aldrich product ph indicator strips j hydrocortisone 21 hemisuccinate sodium salt. hepes (crystalline powder) 5 adenine (powder) 6 protease inhibitor cocktail solution 7 paraformaldehyde (crystalline powder) 8 anti p53 mouse mab (do 7) 9 diaminobenzidine tetrahydrochloride hydrate 3. thermo scientific product 10 co2 incubator hepa filter replacement kitincludes hepa 1t co2 disposable inline filter la (99 97% filtering) 4 corning product 12 cryogenic vials 5. millipore product 13 millex gp syringe filter unit 6. agilaent technologies 14 lsab2 staining kit etc ...

Central Medical Services Society - Delhi

22154740 supply of lab consumables: 2 rapid identification test for mtb mpt 64 antigen ( along with assay diluent in every kit ) 3 respirators ( n95 mask ) 4 potassium dihydrogen phosphate anhydrous ( kh2po4 ) a.r 5 di sodium hydrogen phosphate 6 n acetyl l cystein 7 tri sodium citrate 8 brain heart infusion agar 9 latex gloves size s 10 latex gloves size m 11 latex gloves size l 12 50 ml pp tubes for centrifuge 13 single use plastic pasteur pipettes sterile individually 14 disposable loops 10μl 15 sterile dna / rnase free tips, 0.5 10 μl 16 sterile dna / rnase free tips, 20 200 μl 17 sterile dna / rnase free tips, 100 1000 μl 18 long 1 ml tips with filter 19 cryo vial, sterile with cap, 2ml ( for long term storage ) 20 pcr tubes ( 0.2 ml ) 21 cryo tags 22 petri dishes plastic 23 laboratory coat size s disposable sterile 24 laboratory coat size m disposable sterile 25 laboratory coat size l disposable sterile 26 surgical gowns non sterile size s 27 surgical gowns non sterile size m 28 surgical gowns non sterile size l 29 foreceps, individually wrap, sterile 30 filter paper sheets 31 shoe cover 32 head cover 33 single use paper towels 34 bags for waste bin 30 l 35 bags for waste bin 2 l 36 parafilm sealing film 37 biological indicator for monitoring steam sterilization ( b. stearothermophilus ampule no. of spores per ampule: 105 for steam sterilization at 121 degree celsius and 134 degree celsius ) 38 syringe filter ( 33 mm ) for single use sterile 39 sterile indicator tape, autoclave...

Central Medical Services Society - Delhi

21995020 supply of lab consumables: 2 rapid identification test for mtb mpt 64 antigen ( along with assay diluent in every kit ) 3 respirators ( n95 mask ) 4 potassium dihydrogen phosphate anhydrous ( kh2po4 ) a.r 5 di sodium hydrogen phosphate 6 n acetyl l cystein 7 tri sodium citrate 8 brain heart infusion agar 9 latex gloves size s 10 latex gloves size m 11 latex gloves size l 12 50 ml pp tubes for centrifuge 13 single use plastic pasteur pipettes sterile individually 14 disposable loops 10μl 15 sterile dna / rnase free tips, 0.5 10 μl 16 sterile dna / rnase free tips, 20 200 μl 17 sterile dna / rnase free tips, 100 1000 μl 18 long 1 ml tips with filter 19 cryo vial, sterile with cap, 2ml ( for long term storage ) 20 pcr tubes ( 0.2 ml ) 21 cryo tags 22 petri dishes plastic 23 laboratory coat size s disposable sterile 24 laboratory coat size m disposable sterile 25 laboratory coat size l disposable sterile 26 surgical gowns non sterile size s 27 surgical gowns non sterile size m 28 surgical gowns non sterile size l 29 foreceps, individually wrap, sterile 30 filter paper sheets 31 shoe cover 32 head cover 33 single use paper towels 34 bags for waste bin 30 l 35 bags for waste bin 2 l 36 parafilm sealing film 37 biological indicator for monitoring steam sterilization ( b. stearothermophilus ampule no. of spores per ampule: 105 for steam sterilization at 121 degree celsius and 134 degree celsius ) 38 syringe filter ( 33 mm ) for single use sterile 39 sterile indicator tape, autoclave...

G B Pant Hospital - Delhi

21979679 supply of consumable items ( chemicals , diagnostic kits and glassware items for pathology department ) 1 mortar and pestle stone 2 mortar and pestle disposable 3 falcon tubes 50ml 4 falcon tubes 15ml 5 micropipette tips white for 10 μl 6 beads for magnetic stirrer 7 pcr vials 0.5 μl 8 rack for 1.5 ml ependorf tubes 20 positions 9 20 oc pcr mini cooler for 0.2 ml tubes 10 cryobox for storage of cryogenic vial 11 pcr tubes with ultra thin walls ( consumable ) dnaase and rnase free with domed cap 0.2 ml 12 pcr micro tips for 0.5 10 ul autopipette 13 filter barrier aerosol tips for 0.5 10 ul autopipette 14 pcr tube freezer storage box with cover for 0.2 ml tubes with 96 wells position 15 microcentrifuge tube ( 1.5 2 ml size ) freezer storage boxes with 80 wells 16 millipore syringe filter 0.22μl ( 33mm ) for em 17 plastic cups 20ml 18 plastic cups 50ml 19 magnetic bar small 20 magnetic bar large 21 glass screw vials with screw caps 2ml ( 9mm ) amber colour, ( rivera / borosil ) 22 glass screw vials with screw caps 2ml ( 9mm ) transparent ( rivera / borosil ) 23 plastic screw vials with screw caps 2ml ( 9mm ) amber colour, tarson 24 plastic screw vials with screw caps 2ml ( 9mm ) transparent, tarson 25 utility carrier aluminium heavy duty sample to be shown ( 380×240×115mm ) 26 dropping bottle ( 30ml, ) 27 dropping bottle ( 60ml ) 28 dropping bottle ( 250ml ) 29 dropping bottle ( 500ml ) 30 wash bottle ( 250ml ) 31 wash bottle ( 500ml 32 wash bottle ( 1000ml 33 glass beaker ( 50ml ) 34 glass beaker ( 100ml ) 35 glass beaker ( 500ml ) 36 glass beaker ( 1000ml ) 37 glass beaker ( 25ml ) 38 syringe filter ( 25mm ) 39 pipette bulb ( upto 100ml ) 40 pipette stand ( 5 ) 41 reagent reservoir ( 75ml ) 42 dancing shaker 43 rotospin test tube rotator ( 24×1.5ml tubes ) 44 rotospin rotary mixer ( 20×15ml tubes ) 45 rotospin rotary mixer ( 12×50ml tubes ) 46 rack for micro centrifuge tube 5ml ( 16places ) 47 rack for micro centrifuge tube 1.5ml ( 24places ) 48 rack for micro centrifuge tube 0.5ml ( 24places ) 49 polywire micro tube rack ( 1.5ml ) 96 places 50 universal combi rack 51 test tube stand ( small ) 52 test tube stand ( large ) 53 micro pestle 54 tube conical bottom ( 15ml sterile ) 55 tube conical bottom ( 50ml sterile ) 56 float rack ( 1.5 ml ) 57 drying rack ( 20 pegs ) 58 drying rack ( 30 pegs ) 59 cryo presevation vial self standing sterile ( 1.8ml ) 60 cryo presevation vial self standing sterile ( 4.5ml ) 61 card board cryo box ( 100 places for 1ml / 2mlvials ) 62 card board cryo box ( 36places for 15ml / 50mlvials ) 63 0°c mini cooler ( 32 places for 1.5 ml vials ) 64 20°c mini cooler ( 32 places for 1.5 ml vials ) 65 ice bucket ( 2.5 liter capacity ) 66 cryo gloves water proof–wrist m 67 amber storage vials 2ml 68 amber storage vials 4.5ml 69 tissue culture flack with filter cap sterile 25cm2 70 tissue culture flack with filter cap sterile 75cm2 71 tissue culture flack with filter cap sterile 175cm2 72 parafilm m 4”×125’ 73 parafilm dispenser 74 petri seal 0.5×108 75 indicator tape for steam autoclave 1×500 76 3 / 8 tough spots 5 up assorted colours 77 cryo blades 32.5×12.7mm 78 cryo tags 38×19mm 79 tough tags station 80 kimwipes 11.17×21.3cm 81 kimwipes 37.33×42.16cm 82 nitrile gloves ( small ) 83 nitrile gloves ( medium ) 84 nitrile gloves ( large ) 85 hand protector grip 86 measuring scoop ( 10 ) 87 measuring scoop ( 50 ) 88 measuring scoop ( 100 ) 89 measuring scoop ( 1000 ) 90 measuring scoop ( 500 ) 91 ria vial ( flow cytometer tubes ) 12×75mm 92 pcr tube rack 96places 93 magnetic stirrer hot plate 18×18cm 94 assorted round magnetic stirrer bar with pivot ring 95 staning box ( 12.5×12.5×5cm ) 96 staning box ( 22.5×22.5×5cm ) 97 gel scoop ( 7.5×10cm ) 98 gel scoop ( 20×20cm ) 99 slide storage rack 100 / 200 places 100 slide dispencer 50 places 101 sharp container 5lits 102 autoclavable bags ( 12”×24”, ) 103 autoclavable bags ( 24”×36” ) 104 uv safety goggles 105 aerosol filter tips, racked and pre sterilized, dnaase, rnaase , endotoxin free, 100μl , 200μl ( axygen ) 106 aerosol filter tips, racked and pre sterilized, dnaase, rnaase , endotoxin free, 1000 μl ( axygen ) 107 microcentrifuge tubes, for molecular biology, 1.5ml, dnaase, rnaase, endotoxin free, autoclavable ( axygen ) 108 pcr tubes 0.2ml, flat cap, clear, for molecular biology, dnaase, rnaase, endotoxin free, autoclavable ( ( axygen ) 109 plastic coplin jars tarson 50ml 110 glass coplin jars rivera / borosil 50ml 111 microtip box 96 positions 112 i.            0.2 10 ul 113 ii.            20 200 ul 114 iii.            200 1000 ul 115 measuring cylinder, material: tpx autoclavable, ( tarson ) 2000 ml 116 absolute alcohol / ethanol analytical 117 acetic acid ar 118 acetone ar 119 acid fuschin 25 gm 120 aec chromogen for ihc on paraffin sections 121 agarose ) ( sigma a6138 ) 122 alcian blue 123 aluminium chloride 124 ammonia silver 125 ammonia solution 126 ammonium aluminium sulphate r 127 ammonium chloride ( ar ) 128 ammonium oxalate 129 ammonium sulphate 130 ammonium sulphide ( yellow ) 131 aniline blue 132 aniline blue 133 barium chloride 10% ar 134 basic fuchsin 135 biebrich scarlet 136 boric acid for molecular biology, 137 bovine serum albumin 138 calcium chloride ar 139 carmine stain 140 carrier tray ( biochrom ) 141 catalase enzyme 142 charcoal 143 chlorhexidime hand rub 144 chromotrope 2r 145 citric acid 146 coenyzme nadh 147 concentrated sulphuric acid 148 congo red 149 coomasie blue ( g 250 ) : for electrophoresis ( sigma aldrich ) 150 coplin jar 151 cresyl fast violet 152 crystal violet / gentian violet powder 153 cytospin ( shandon ) disposable cards ( two hole ) per packet 154 dab substrate and chromogen for ihc 155 dapi 1 ( vysis ) 156 dapi 2 ( vysis ) 157 dextrine / dextrose anhydrous 158 diethyl ether 159 dipotassium hydrogen phosphate 160 disodium hydrogen phosphate anhydrous 161 dispenser for 25 liter solution container 162 dispenser for 50 liter solution container 163 disposable esr tube ( imported ) westergreen sample to be shown 164 disposable esr tube ( indian ) westergreen 165 dmp 30 ( imported em grade 166 dmso ( sigma aldrich ) 167 dpx mounting ar 200 unit 168 egg albumin 169 eosin y ( ar ) 170 ethanol 70% 171 ether 500 ml 172 fast green fcf 173 ferric chloride 174 fetal bovine serum 175 filter paper whatmann no.42 circular ( each ) 10 cm diameter 176 formaldehyde ar 177 fouchet’s regent ar ortho 178 gel loading solution: for electrophoresis ( sigma aldrich ) 179 gelatin 180 giemsa stain powder 181 glass graduated centrifuged test tubes 15 ml vol with conical base 182 glass tough staining jars for 19 slides 183 glucose 1 –phosphate sigma 184 glycerine ar 185 glycogen 186 gold chloride ar 187 haematoxylin ( sigma ) 188 hexamethylene tetramine 189 histopaque ( sigma 1119 1 ) 190 hydrochloric acid ar 191 hydroquinone 192 ice bucket suitable for liquid nitrogen, dry ice and acetone ( biochrom ) 193 iodine ar ortho 194 iron alum 195 isopentane 196 isopropyl alcohol feisher 197 laboratory cell counter ( manual ) 198 laboratory, filter paper 199 lancets 200 lead nitrate 201 light green 202 liquid nitrogen 203 liquid paraffin 204 lithium carbonate 205 luxol fast blue 206 magnesium chloride 207 magnesium chloride ( ar ) 208 magnesium sulphate 209 martius yellow ( acid yellow 24 ) ( ci 10315 ) 210 martius yellow ( sigma / merck ) 211 mayer’s haematoxylin 212 melachite green powder 213 merck pap solution 1a 60925301251730 214 merck pap solution 2b 60688701251730 215 merck pap solution 3b 60927201251730 216 mercuric oxide 217 methanol 218 micro hematocrit capillaries ( plain ) 219 micro slide boxes for 10 slides 220 micro slide boxes for 100 slides 221 micro slide boxes for 200 slides 222 micro slide boxes for 5 slides 223 microscopic glass slides size 75 x 25 x 1mm deluxe 224 milli q water 225 multistix for urine analysis 226 n, n dimethyl p phenylenediamine dihydrochloride – sigma 227 naoh pellets ( vysis ) 228 naphthol asb1 phosphate n 2250 sodium salt 229 neubaur’s chambers with cover slip 230 neutral red powder 231 nitric acid ar 232 nitroblue tetrazolium ( sigma n 6876 ) 233 nuclear fast red 234 oil immerssion for microscopy 235 orange g ( sigma ) 236 orcein sigma / loba o 7380 237 ortho tolidine powder for occult blood 238 oxalic acid 239 paraffin wax ( melting ) at 60 62 deg c ) 240 pbs sachets to make i litre buffer 241 pepsin p7000 242 pepsin p7012 243 periodic acid ar. 244 petridish – 5 cm corning 245 petridish 15 cm corning 246 ph paper with 0.5 1 ph increments range 4 7 247 phosphate buffer saline: for western blot ( sigma aldrich ) 248 phospho molybidic acid 249 phospho tungstic acid ( ar ) 250 picric acid 251 poly lysine solution 252 potassium dichromate ( lr ) 253 potassium dihydrogen phosphate 254 potassium ferrocyanide 255 potassium iodine 256 potassium meta bisulphate 257 potassium permanganate kmno4 258 proteinase sigma 259 rhodanine stain – sigma 260 rubeanic acid– sigma 261 silver nitrate exelar. 262 sirius red / direct red 80 – sigma 365548 263 slide mailer 264 sod. nitroprusside 265 sodium acetate ( ar ) 266 sodium beta glycerophosphate 267 sodium bicarbonate 268 sodium bisulphate 269 sodium carbonate ( ar ) 270 sodium diethyl barbiturate 271 sodium fluoride 272 sodium hydrogen phosphate monohydrate 273 sodium hypochlorite ( lr ) 274 sodium metabisulphite 275 sodium phosphate dibasic 276 sodium phosphate monobasic 277 sodium thiosulphate 278 soluble blue ( methyl blue ) ( sigma code m. 6900 ) c.i. 42780 279 ssc 280 staining box p.p. ( biochrom ) 281 stainless steel embedding moulds – medium 282 stainless steel embedding moulds – small 283 sucrose 284 sulpho salicylic acid ( sigma / merck ) 285 sulphur powder 286 toludine blue loba / e merck 287 tourniquet 288 trichloroacetic acid 289 tris 290 tris glycine buffer : for western blot ( biorad ) 291 tris powder 292 triton x 293 universal indicator paper ph 1 10 294 uristix – for 2 parameters protein & sugar 295 utility tray of size approx 8”x10’ 296 victoria blue sigma 234176 297 wintrobe tubes 298 wire basket 8”x8”x8” 299 xylene ar 300 xylene feisher 301 xylene feisher 302 yorko’s disposable knife for grossing 303 new methylene blue 304 cryo embedding compound 305 filter paper whatmann sheets no.42 306 edta vacutainer 3ml 307 esr vacutainer 308 immunofluorescence kit – mosaic of multibiochips for doing ana, anti sm & ama ( multibiochips of hep 2 cells, stomach, liver, kidney ) 309 conical flask 250 ml ( corning ) 310 conical flask corning / borosil 5 lit. 311 conical flask ( borosil ) 500 ml. 312 flat bottom round flask 1 ltr. capacity 313 flat bottom round flask 2 ltr. capacity 314 coplin jar vertical for five slides ( borosil ) 315 coplin jars for 5 slides ( plastic ) 316 eppendrof tubes ( imported autoclaved, suitable for molecular biology work ) 2ml 1000 pieces 317 eppendrof tubes ( imported autoclaved, suitable for molecular biology work ) 1.5ml 318 falcontubes ( 15ml, imported ) 1000 319 funnel glass 100 mm diameter 320 permanent marker pens luxor. camline 321 glass marking hb pencils 322 glass marking pens 323 graduated cylinders borosil 10 ml, 6 324 graduated cylinders borosil 100 ml, 6 325 graduated cylinders borosil 250 ml, 326 graduated cylinders borosil 500 ml, 327 graduated cylinders borosil 1 lt. 328 graduated cylinders borosil 5 lt. 329 imported coverslips ( english glass no 1 ) – size 22 x 22 mm 10 gm pack 330 imported coverslips ( english glass no 1 ) – size 24 x 24 mm 10 gm pack 331 imported coverslips ( english glass no 1 ) – size 24 x 40 mm 10 gm pack 332 imported coverslips ( english glass no 1 ) – size 24 x 50 mm 10 gm pack 333 imported coverslips ( english glass no 1 ) – size 24 x 60 mm 10 gm pack 334 pipette ( pasture ) dropper with teat ( graduate ) 335 plastic jet cassette with lid 336 slides 3”x1” thickness 1.10 mm 337 test tube ( borosil ) 2 ½” 338 test tube ( borosil ) 4” 339 test tube ( borosil ) 5” 340 glass beaker ( borosil ) 50ml 341 glass beaker ( borosil ) 100ml 342 glass beaker ( borosil ) 250 343 glass beaker ( borosil ) 500ml 344 glass beaker ( borosil ) 1000 ml 345 graduated cylinders borosil 1lt. 346 glass pipette tc1ml – borosil blow out 347 glass pipette tc 5ml – borosil blow out 348 glass pipette tc 10ml borosil 349 glass bottles, schott duran 100ml, graduated, autoclavable, for molecular biology applications – 350 glass bottles, schott duran 250ml graduated, autoclavable, for molecular biology applications – 351 glass bottles, schott duran 500ml graduated, autoclavable, for molecular biology applications – 352 glass bottles, schott duran 1000ml graduated, autoclavable, for molecular biology applications – 353 tips for micropipette 1000 micro litre1 pkt – 1000 blue tips 354 tips for micropipette 100 micro litre1 pkt – 1000 yellow tips 355 test tube racks ( metal ) 48 holes 356 test tube racks ( plastic ) 48 holes 357 test tube racks ( plastic ) 100 holes 358 sterile container disposable 20ml vial 359 steriware petridishes 10 cm ( disposable ) 15 cm ( disposable ) 360 micro centrifuge tubes ( autoclaved ) conical bottom1.5 ml 361 centrifuged test tubes 15 ml vol with conical base 362 box for 100 micro tips 363 box for 96 micro tips 364 test tube racks plastic ( 100 holes ) 365 test tube racks plastic for big tubes 6 or 12 holes 366 test tube stand36 holes / 24 holes 367 blue microtips stand ( 96 holes ) 368 yellow tip stand 369 white tip stand 370 micropipette variable volume ( 20ul 200ul ) imported us fda approved easy maintence large display for easy viewing light tip ejection force ) 371 micropipette multichannel 8 channel volume 10 – 100 microlitre imported us fda approved 372 micropipette variable volume ( 100ul 1000ul imported us fda approved large display for easy viewing light tip ejection force ) 373 micropipette multichannel 8 channel volume ( 50.0ul 300ul ) imported us fda approved 374 rubber teats which would fit on to pasteur pipettes and pipettes and 0.1 & 0.5 ml pipette 375 block cabinet 20000 376 centrifuge tube, conical bottom, sterile, capacity 15ml, material: pp / hdpe autoclavable ( tarson ) ten packs ( 280 per pack ) 377 rack with cover, designed for storage of 96, 1.5ml microcentrifuge tubes or 2 ml tubes, material: pp autoclavable ( tarson ) 4 pieces per pack 378 centrifuge tube, conical bottom, sterile, capacity 50ml, material: pp / hdpe autoclavable ( tarson ) ( 280 per pack ) 379 sample vials with screw caps flat bottom 2ml plastic 380 acid proof gloves ( pair ) large size upto elbow 381 stop watch for hour & second 382 stainless steel embedding moulds – large 383 brush big 384 brush small 385 filter paper sheet no.1, 12.5mm ( whatman no. 1 ) 100 sheets / pack 386 aluminium foil rolls 1 kg roll 387 parafilm roll 388 pestle morter big 389 sterile scalpel blades 390 tissue paper roll 391 cryo gloves, mid arm, medium ( tarson ) 392 cello tape ( 2 cm breadth ) 393 hand lens 394 room thermometer ( digital ) 395 disposable needle 21g 1 ½ inch 396 disposable needle 22g 1 ½ inch 397 white tips for micropipette – autoclavable 2 10 microliter 398 filter paper whatmann no.42 circular ( each ) 8cm diameter 399 filter paper sheets routine ( blotting paper ) 400 h2 so4 con lab grade 2.5 liters 401 vaccutainer black top citrate 3ml capacity 402 vaccutainer edta 1.5ml capacity 403 diamond glass pencil 404 disposable knife for microtome – high profile 405 disposable knife for microtome low profile 406 fine forceps – disposable – 407 laboratory thermometer ( 0 100 degree centigrade ) 408 stainless steel tray with cover 18 x 24 inches 409 ph paper strips, range 2 10.5 ( 10strips / box ) 410 ph paper strips, range 3.5 6, ( 10strips / box ) 411 ph paper strips, range 5 7.5, ( 10strips / box ) 412 ph paper strips, range 6.5 9, ( 10strips / box ) 413 ph paper strips, range 8 10.5, ( 10strips / box ) 414 borax 500 gm / 100 gm 415 aluminium trays slides for 20 slides 416 sodium hypoclorite for disinfection 5 ltr can 417 potassium dichromate 418 cryo labels, able to withstand crygenic storage conditions and boiling waterbaths at 100°c and dry heat upto 150°c, 32.5x12.7mm ( tarson ) 419 teepol 5 litre 420 glacial acetic acid 500 ml 421 sodium hydroxide 500 gm 422 potassium hydroxide 500 gm. 423 india ink 424 potassium chloride ( ar ) 425 phenol 426 sodium chloride 500 gm 427 sodium citrate 500 gm 428 hydrochloric acid con. ar grade 1 liters 429 methylene blue 100gm 430 hydrogen peroxide 1 ltr. 431 glucose ar 500 gm 432 calcium oxide 433 calcium chloride 434 tourniquettes for drawing venous blood 435 formaldehyde ar 436 falcontubes ( 25ml, imported ) 1000 437 falcontubes ( 50ml, imported ) 1000 438 conical flask corning / borosil 100ml 439 flat bottom flask 500 ml 440 flat bottom flask 200 ml 441 coverslip indian 20 x 20 mm 442 coverslip indian 18 x 18 mm 443 plastic pipette ( pasture ) with self teat ( graduate ) 200 packet 444 slides 3”x1” thickness 1.35 mm 445 test tube ( borosil ) 6” 150 x 18 mm 446 glass beaker ( borosil ) 2000 ml 447 glass pipette tc 2ml – borosil blow out 448 test tube racks ( plastic ) 36 holes 449 brownpacking tape brown ( 5 cm breadth ) 450 venepunture site seal 451 brown paper thick per rim 452 brown paper thin per rim 453 glass graduated centrifuged test tubes 15 ml vol with conical base 454 test tube racks ( plastic ) 6 holes for / 25 / 50 ml 455 stainless steel embedding moulds – medium 456 stainless steel embedding moulds – small 457 3, 3’ dab ( sigma ) powder tablet. 458 aec chromogen for ihc on paraffin sections ( suitable for dual staining ) 459 antibody to brachyury for ihc conc on paraffin sections, rtu 460 antibody to cd1a for ihc on paraffin sections rtu 461 antibody to cd1a for ihc on paraffin sections, conc 462 antibody to desmin for ihc conc 463 antibody to desmin for ihc rtu 464 antibody to inhibin1 for ihc on paraffin sections, rtu 465 antibody to merosin ( laminin alpha 2 chain ) 466 antibody to napsin for ihc on paraffin sections, rtu 467 antibody to n myc for ihc on paraffin sections, concentrated 468 antibody to sall4for ihc on paraffin sections, rtu 469 antibody to sox4 for ihc on paraffin sections, rtu 470 antibody to acth for ihc rtu 471 antibody to actin ( smooth muscle ) for ihc concentrated 472 antibody to actin ( smooth muscle ) for ihc rtu 473 antibody to al amyloid for ihc on paraffin sections rtu 474 antibody to alfa 7 integrin for ihc conc 475 antibody to alfa feto protein for ihc rtu 476 antibody to alfa synuclein for ihc conc 477 antibody to alk 1 for ihc on paraffin sections ( spring; m444 ) rtu 478 antibody to alpha actinin 4 ( cd2ap ) for ihc 479 antibody to alpha dystroglycan 480 antibody to alpha internexin for ihc on paraffin sections, conc 481 antibody to alpha internexin for ihc on paraffin sections, rtu 482 antibody to alpha sarcoglycan ncl a sarc 483 antibody to anti cmv for ihc rtu 484 antibody to anti hsv for ihc concentrated 485 antibody to anti tgf beta1 for ihc ( rtu ) 486 antibody to anti tlr 3 for ihc ( concentrated ) 487 antibody to anticollagenase 4 for ihc on paraffin section 488 antibody to anticollagenase 6 for ihc on paraffin section 489 antibody to anticollagen type i ( calbiochem ) 490 antibody to antimouse igg conjugated with alexaflor 488 for ihc conc 491 antibody to bcl 2 for ihc on paraffin sections rtu 492 antibody to beta sarcoglycan ncl b sarc 493 antibody to beta spectrin 494 antibody to beta catenin 1 for ihc formalin fixed paraffin embedded tissue rtu 495 antibody to beta catenin 1 for ihc formalin fixed paraffin embedded tissue concentrated 496 antibody to bsep abcb11 for ihc on paraffin sections sigma hpa019035 497 antibody to ca 19 9 for ihc rtu 498 antibody to calcitonin for ihc ( rtu ) 499 antibody to caldesmon for ihc rtu 500 antibody to calpain 1ml done calp3c / 12a 2 501 antibody to calretinin for ihc concentrated 502 antibody to calretinin for ihc rtu 503 antibody to cam 5.2 for ihc concentrated 504 antibody to cam 5.2 for ihc rtu 505 antibody to carcino embryonic antigen ( cea ) for ihc conc 506 antibody to carcino embryonic antigen ( cea ) for ihc rtu 507 antibody to caspase –1 ( ihc ) ( concentrated ) 508 antibody to caspase –3 ( ihc ) ( concentrated ) 509 antibody to caveolin 510 antibody to cd – 133: rabbit polyclonal antihuman for ihc on paraffin sections rtu 511 antibody to cd – 133: rabbit polyclonal antihuman for ihc on paraffin sections concentrated 512 antibody to cd 10 for ihc paraffin rtu 513 antibody to cd 23 for ihc on paraffin sections rtu 514 antibody to cd 44 for paraffin ihc rtu 515 antibody to cd 45 – ro for ihc concentrated 516 antibody to cd 45 – ro for ihc rtu 517 antibody to cd 99 for ihc on paraffin sections rtu dako clone 12e7 / ir057 518 antibody to cd15 antibody for ihc on paraffin sections rtu 519 antibody to cd20 for ihc concentrated 520 antibody to cd20 for immunohistochemistry rtu 521 antibody to cd21 for ihc on paraffin sections rtu 522 antibody to cd3 for ihc for paraffin sections rtu 523 antibody to fsh for ihc rtu 524 antibody to cd30 for immunohistochemistry rtu 525 antibody to cd31 antibody for ihc ( concentrated ) 526 antibody to cd31 antibody for ihc rtu 527 antibody to cd34 antibody for ihc ( concentrated ) 528 antibody to cd34 antibody for ihc rtu 529 antibody to cd4 for ihc for paraffin sections rtu 530 antibody to cd5 for ihc on paraffin sections rtu 531 antibody to cd56 for ihc on paraffin sections rtu 532 antibody to cd56 for ihc on paraffin sections, conc 533 antibody to cd68 for immunohistochemistry conc 534 antibody to cd68 for immunohistochemistry rtu 535 antibody to cd8 for ihc for paraffin sections rtu 536 antibody to soluble cd 25 for ihc for paraffin sections rtu 537 antibody to cdx – 2 for ihc paraffin concentrated 538 antibody to cdx – 2 for ihc paraffin rtu 539 antibody to chromogranin for ihc concentrated 540 antibody to chromogranin for ihc rtu 541 antibody to ck 7 for ihc concentrated 542 antibody to ck 7 for ihc rtu 543 antibody to ck18 m30 fragment for paraffin ihc 544 antibody to ck20 antibody for ihc ( concentrated ) 545 antibody to ck20 antibody for ihc rtu 546 antibody to ckit / cd117 ihc* pab4502 conc 547 antibody to ckit / cd117 for ihc* pab4502 rtu 548 antibody to claudin 1 for ihc on paraffin sections rtu 549 antibody to c myc for ihc on paraffin sections, conc 550 antibody to collagen vi for ihc, conc 551 antibody to complement mac, for ihc concentrated 552 antibody to complement mac, for ihc rtu 553 antibody to crp ( c reactive protein ) for ihc on paraffin sections, conc 554 antibody to ctnnb1 for ihc on paraffin sections, conc 555 antibody to cyclin d1 clone: rabbit polyclonal antihuman for ihc rtu 556 antibody to cyclooxygenase – 2 ( cox 2 ) for ihc rtu 557 antibody to cytokeratin ( pan / ae1 / ae3 ) for ihc conc 558 antibody to cytokeratin ( pan / ae1 / ae3 ) for ihc rtu 559 antibody to cytokeratin 8 for ihc ( low molecule wt. ) rtu 560 antibody to cytokeratin clone mnf 116 for ihc rtu 561 antibody to cytokeratin18 for immunohistochemistry rtu 562 antibody to cytokeratin19 for ihc rtu 563 antibody to cytokeratin5 / 6 antibody for ihc ( rtu ) 564 antibody to cytokeratin5 / 6 antibody for ihc concentrated 565 antibody to d2 40 antibody for ihc rtu ( paraffin ) 566 antibody to delta sarcoglycan ncl d sarc 567 antibody to dog 1 antibody for ihc rtu 568 antibody to dysferlin ( hamlet ) 1 ml clone ham 1 / 7b6 569 antibody to dysferlin ( hamlet ) 1 ml clone ham3 / 17b2 570 antibody to dystrophin c terminal 1ml; ncc dys 2; clone dy8 / 6c5 571 antibody to dystrophin clone 13h6 ncl dys a 572 antibody to dystrophin clone 34c5 ncl dys b 573 antibody to dystrophin n terminal 1ml; ncl dys 3; clone dy10 / 12b 2 574 antibody to dystrophin rod domain 1ml; ncl dys 1;clone dy4 / 6d3 575 antibody to e–cadherin clone: nch – 38 for ihc on paraffin sections concentrated 576 antibody to egfr ( type iii ) for ihc rtu 577 antibody to ema ( epithelial membrane antigen ) for ihc conc 578 antibody to ema ( epithelial membrane antigen ) for ihc rtu 579 antibody to emerin clone 4g5 580 antibody to ep– cam: rabbit polyclonal antihuman for ihc on paraffin sections rtu 581 antibody to ep– cam: rabbit polyclonal antihuman for ihc on paraffin sections concentrated ( bio sb; 6280 ) 582 antibody to factor viii related antigen for ihc rtu 583 antibody to yap 1 on paraffin section ihc 584 antibody to gab1 for ihc on paraffin sections, conc 585 antibody to gamma sarcoglycan ncl g sarc 586 antibody to gastrin for ihc rtu 587 antibody to gfap antibody for ihc – monoclonal conc 588 antibody to gfap antibody for ihc – monoclonal rtu 589 antibody to ggt antibody for ihc on paraffin sections, conc 590 antibody to gli1 for ihc on paraffin sections, conc 591 antibody to glutamine synthetase clone gs6 for ihc on paraffin sections, conc 592 antibody to glypican 3 clone1g12: rabbit polyclonal antihuman for ihc ( rtu ) 593 antibody to growth hormone for ihc rtu 594 antibody to hbcore for ihc ( for paraffin section ) rtu 595 antibody to hbs ag for immunohistochemistry rtu 596 antibody to hepatocyte ( clone och1e5 ) for ihc concentrated 597 antibody to hepatocyte ( clone och1e5 ) for ihc rtu 598 antibody to her2neu for ihc clone k 5204, k5207, 5k001, rrmabclone 4b5 rtu 599 antibody to her2neu for ihc clone k 5204, k5207, 5k001, rrmabclone 4b5 concentrated 600 antibody to hla – class i for ihc concentrated 601 antibody to hla – dr for ihc concentrated 602 antibody to hmb45 for ihc rtu 603 antibody to hsp70 heat shock protein 70 for ihc on paraffin sections, concentrated 604 antibody to icam – 1: rabbit polyclonal antihuman for ihc on paraffin sections concentrated 605 antibody to idh 1 antibody for ihc on paraffin sections concentrated 606 antibody to iga for immunohistochemistry rtu 607 antibody to igg cd 138 for ihc, rtu 608 antibody to igg cd 79 a for ihc, rtu 609 antibody to igg for immunohistochemistry rtu 610 antibody to igg 4 antibody for ihc on paraffin sections concentrated 611 antibody to igg 4 antibody for ihc on paraffin sections rtu 612 antibody to igg4 clone mrq44 antibody for ihc on paraffin sections, rtu 613 antibody to igg4 clone mrq44 antibody for ihc on paraffin sections, concentrated 614 antibody to igm for immunohistochemistry rtu 615 antibody to inhibin1 for ihc on paraffin sections, conc 616 antibody to ini1 for ihc on paraffin sections, concentrated 617 antibody to inos for ihc conc 618 antibody to insulin for ihc rtu 619 antibody to jc virus antigen antibody for ihc on paraffin sections rtu 620 antibody to jc virus antigen antibody for ihc on paraffin sections concentrated 621 antibody to kappa light chains for ihc on paraffin section 622 antibody to kcna1 for ihc on paraffin sections, conc 623 antibody to lambda light chains for ihc on paraffin sections 624 antibody to lamin a / c for ihc, conc 625 antibody to lca antibody for ihc concentrated 626 antibody to lca antibody for immunohoistochemistry rtu 627 antibody to l fabp ( liver fatty acid binding protein ) for ihc on paraffin sections, concentrated 628 antibody to mdr3 abcb4 for ihc on paraffin sections, conc 629 antibody to melan a antibody for ihc rtu 630 antibody to mgmt for ihc on paraffin sections, conc 631 antibody to mib – 1 ( mab clone mib1 / mm1 / rmab56 ) for ihc rtu 632 antibody to mib – 1 ( mab clone mib1 / mm1 / rmab56 ) for ihc concentrated 633 antibody to mic – 2 for ihc concentrated mab clone epr3097y / 12e7 634 antibody to microtubule associated protein 2 for ihc on paraffin sections rtu 635 antibody to microtubule associated protein for ihc conc 636 antibody to microtubule associated protein for ihc rtu 637 antibody to mlh 1 antibody for ihc on paraffin sections 638 antibody to mmp2: rabbit polyclonal antihuman for ihc formalin fixed paraffin embedded tissue conc 639 antibody to moc – 31 for ihc concentrared 640 antibody to moc – 31 for i ihc rtu 641 antibody to mouse monoclonal anti human bk virus for ihc 642 antibody to msh 2 for ihc on paraffin sections conc 643 antibody to msh 2 for ihc on paraffin sections rtu 644 antibody to msh 6 antibody for ihc on paraffin sections rtu 645 antibody to msh 6 for ihc on paraffin sections conc 646 antibody to muc 1 for ihc paraffin rtu 647 antibody to muc – 2 for ihc paraffin rtu 648 antibody to muc 5 ac for ihc paraffin rtu 649 antibody to muc – 6 for ihc paraffin rtu 650 antibody to muscle actin for ihc rtu 651 antibody to myelin basic protein for ihc rtu 652 antibody to myeloperoxidase for ihc rtu 653 antibody to myogenin for ihc on paraffin sections 654 antibody to myosin heavy chain fast ncl mchf 655 antibody to myosin heavy chain fast ncl mhcd 656 antibody to myosin heavy chain slow ncl mhcs 657 antibody to myotilin ( leica, novacastra ) for ihc, conc 658 antibody to napsin for ihc on paraffin sections, conc 659 antibody to ncam for ihc concentrated 660 antibody to ncam for ihc rtu 661 antibody to nephrin for ihc rtu 662 antibody to nephrin for ihc concentrated 663 antibody to nestin for ihc on paraffin sections conc 664 antibody to nestin for ihc on paraffin sections rtu 665 antibody to neurofilament protein antibody for ihc conc 666 antibody to neurofilament protein antibody for ihc rtu 667 antibody to neuron specific beta iii tubulin for ihc on paraffin sections, concentrated 668 antibody to neuronal nuclei ( neu n ) for ihc on paraffin sections, conc 669 antibody to npr3 for ihc on paraffin sections, conc 670 antibody to nse for ihc paraffin rtu 671 antibody to oct4 for ihc on paraffin sections, rtu 672 antibody to olig2 for ihc on paraffin sections, conc 673 antibody to ov 6: rabbit polyclonal antihuman for ihc on paraffin sections concentrated 674 antibody to p16 ink 4a for ihc rtu 675 antibody to p 53 protein ( do 7 ) for ihc concentrated 676 antibody to p 53 protein ( do 7 ) for ihc rtu 677 antibody to pancreatic polypeptide for ihc conc 678 antibody to pcna for immunohistochemistry rtu 679 antibody to pgdfr beta antibody for ihc conc 680 antibody to phosphohistone h3 ( phh3 ) for ihc on paraffin sections, rtu 681 antibody to placental alkaline phosphatase for ihc rtu 682 antibody to pms 2 for ihc on paraffin sections conc 683 antibody to pms 2 for ihc on paraffin sections rtu 684 antibody to podosin ( nphs 2 ) for ihc concentrated 685 antibody to podosin ( nphs 2 ) for ihc rtu 686 antibody to polyclonal cea for ihc rtu 687 antibody to polyclonal ubiquitin for ihc rtu 688 antibody to prolactin for ihc rtu 689 antibody to protein gene product pgp 9.5 for ihc rtu 690 antibody to pten for ihc on paraffin sections rtu 691 antibody to s – 100 for ihc concentrated 692 antibody to s – 100 for immunohistochemistry rtu 693 antibody to s100a4 : rabbit polyclonal antihuman for ihc formalin fixed paraffin embedded tissue conc 694 antibody to saa ( amyloid a ) for ihc on paraffin sections, rtu 695 antibody to sall4 for ihc on paraffin sections, conc 696 antibody to serotonin for ihc rtu 697 antibody to sfrp1 for ihc on paraffin sections, conc 698 antibody to shh for ihc on paraffin sections, conc 699 antibody to somatostatin for ihc rtu 700 antibody to synaptophysin for ihc concentrated 701 antibody to synaptophysin for ihc rtu 702 antibody to terminal deoxynucleotidyl transferase for ihc rtu 703 antibody to transthyretin ihc paraffin concentrated 704 antibody to tsh for immunohistochemistry rtu 705 antibody to utrophin ( leica, novacastra ) for ihc, conc 706 antibody to vimentin for ihc concentrated 707 antibody to vimentin for immunohistochemistry rtu 708 antibody to wnt for ihc on paraffin sections, conc 709 antibody to wt 1 for ihc paraffin, rtu 710 antibody to a inhibin for ihc on paraffin sections, rtu 711 dab substrate and chromogen for ihc 712 lsab for ihc – universal ( mouse & rabbit ) 713 lsab for ihc universal ( mouse & rabbit ) 714 micro polymer detection kit for ihc 715 pepsin p7000 powder, =250 units / mg solid ( sigma ) 716 pepsin p7012 717 poly l lysine solution 718 pronase ( sigma ) 719 protease type xxiv ( sigma p8038 ) 720 proteinase sigma 721 secondary antibody antimouse goat igg tagged to alexa flour 488 722 secondary antibody antirabbit goat igg to alexa flour 488 723 antibody to arginase 1, rtu 724 antibody to arginase 1, conc 725 fitc conjugated antihuman fibrinogen antibodies dako ( conc ) 726 fitc conjugated antihuman c3, ( conc ) antibodies 727 antibody to rabbit anti human c4d cell marque ( rtu ) 728 antibody to anti pla2r sigma hpa012657 ( conc ) 729 antibody to anti atrx antibody sigma hpa001906 730 antibody to anti mum1 antibody –clone eau32 rtu leica 731 antibody to anti p40 clone bc28 concentrated 732 antibody to anti hmw ck 34betae12 dako concentrated 733 antibody to anti er clone ep1 rtu 734 antibody to anti pr clone pgr1294 rtu 735 antibody to anti pax8 clone mrq50 concentrated 736 antibody to anti amacr clone 13h4 rtu 737 antibody to anti nanog clone d73g4 cell signaling technology concentrated 738 antibody to anti sox2 clone d1c7j cell signaling technology concentrated 739 antibody to anti l1cam ( sigma ; uj127 ) concentrated 740 antibody to anti filamin a filzgerald concentrated 741 antibody to anti satb2 sigma aldrich concentrated hpa001042 742 antibody to anti cdh17 cell marque concentrated / hpa023614 sigma 743 antibody to anti gcet dako concentrated 744 anti psa clone 35h9 leica cncentrated 745 antibody to anti ca 125 clone ov185:1 leica rtu 746 antibody to anti p63 for ihc on ffpe 747 antibody to anti ck5 / 6 antibody 748 antibody to anti abcc2 ( mrp2 ) antibody produced in rabbit hpa004860 sigma 749 antibody to anti cdh17 cell marque concentrated / hpa023614 sigma 750 anti braf v600e for ihc ( ve1 specific for braf pv600e ) 751 pap pen for ihc 752 anti vhl antibody produced in rabbit ab4503075 sigma 753 antibody to anti map2 antibody rtu 754 antibodies ck 3 755 antibodies ck 19 rtu 756 antibodies to mac ( c 5 9 ) conc 757 antibody p62 rtu 758 antibody tdp 43 759 antibody mhcn 760 antibody to show loss of h3k 27m me3 conc ( 07–449, millipore ) 761 h3k27 antibody ( abcam; ab6002 ) 762 antibody to rabbit polyclonal anti ezh2 ( 5246, cell signaling ) conc 763 antibody to c1119mc–rela fusions 764 antibody to ebp 50 conc 765 antibody to p65 conc 766 antibody to fl1 767 antibody to sox 10 768 antibody to anti dnmt1 antibody ( clone h 300, dilution 1:200; santa cruz biotechnology, santa cruz, ca, usa ) , 769 antibody to anti dnmt3a antibody ( clone 64b1446, dilution 1:200; imgenex, 770 antibody to dnmt3b ( clone 52a1018 1:200 ) 771 bcl 6 anti body conc 772 cdk 4 anti body conc 773 gata2 antibody conc 774 mdm2 antibody conc 775 pck1 conc 776 sf 1 conc 777 bob 1 conc 778 pit 1 conc 779 antigap43 antibody 780 anti eber associated protein antibody, polyclonal 781 brilliant cresyl blue 782 phospho. anti nf kb p65 antibody 783 anti stat6 antibody 784 anti cd 19 antibody 785 anti cd 38 antibody 786 anti pten ab 787 anti ck9 antibody 788 anti gh antibody 789 anti lh beta antibody 790 anti tsh alpha antibody 791 anti fsh alpha antibody 792 anti hpv antibody 793 anti ebv nuclear antigen ab 794 anti ebv latent memb. protein 795 anti cd 163 796 anti gap43 antibody 797 anti lin28 antibody ( preferably thermoscientific ) 798 xl iso ( 17q ) 799 brilliant cresyl blue 800 fecal occult blood test ( fobt ) , kit 801 phospho. anti nf kb p65 antibody 802 anti stat6 antibody 803 anti ck3 antibody 804 anti p16 antibody 805 anti ck9 antibody 806 anti cd kn2a / p14 antibody 807 anti pax 5 antibody 808 anti thyroglobulin antibody 809 anti ck7 for flow cytometry 810 anti epcam for flowcytometry 811 anti ck8 for flowcytometry 812 sstr 2a 813 calulonin 814 ca125 815 ca 19.9 816 thyropanoxiden 817 lin 28 818 p14 819 marlin 820 epb 1 821 ebf 50 822 spectrin 823 pdl 1 824 renal cell carcinoma 825 anti body cd163 826 antibody to ttf 1 antibody for ihc rtu 827 0.5 m edta ( ph 8.0 ) solution 828 10x sera lysis buffer 829 5 5’ diethyl barbiturate 830 absolute alcohol / ethanol analytical 831 acetic acid 100% for molecular biology, 832 acetyl thiocholine iodide a 5751 sigma 833 acrylamide 834 bisacrylamide: 40% solution ( sigma aldrich ) 835 adenosine 5 monophosphate 836 adenosine 5 triphosphate disodium salt ( sigma ) a 7699 837 adenosine tri phosphate 838 agarose for molecular biology ( sigma aldrich ) ( sigma a6138 ) 839 ambion nuclear free water 840 ammonium per sulphate: for electrophoresis ( sigma aldrich ) 841 bis acrylamide 842 blue tips ( autoclaved made of ultra high molecular weight polyethelyene suitable for molecular biology work with racks ) 843 boric acid for molecular biology, 844 bovine serum albumin: for western blot ( sigma aldrich ) 845 brij 846 catalase enzyme 847 coenyzme nadh 848 coomasie blue ( g 250 ) : for electrophoresis ( sigma aldrich ) 849 cryogenic apron 1.5 meter 850 dispenser for 25 liter solution container 851 dispenser for 50 liter solution container 852 dmso ( sigma aldrich ) 853 dna extraction kit ( qiagen / invitrogen ) : 250 samples for 12 x 96 dna minipreps: genomic spin columns, plates, proteinase k, digestion buffer, lysis / binding buffer, wash buffers, elution buffer, rnase a, s blocks, airpore tape sheets, collection microtubes ( 1.2 ml ) , elution microtubes rs, caps, 96 well plate registers 854 dna isolation kit ( 50 preps ) for isolation of genomic dna from animal cells, animal tissues, whole blood, buffy coat, plasma, serum, bacteria, yeasts, viruses, paraffin embedded tissues etc. using spin column method. five kits 855 dna molecular weight marker 100bp ladder, 30mg 856 dntp: for electrophoresis ( sigma aldrich ) : dntp 100a: 857 dntps ( datp, dgtp, dctp, dttp ) 858 dntps 100mmolar solution consisting of datp, dctp, dgtp and dttp 859 ethidium bromide for electrophoresis ( sigma aldrich ) 860 ethylene diamine tetraacetic acid, disodium salt, dihydrate for molecular biology 861 gel loading solution: for electrophoresis ( sigma aldrich ) 862 glass graduated centrifuged test tubes 15 ml vol with conical base 863 glass tough staining jars for 19 slides 864 glucose 1 –phosphate sigma 865 histopaque ( sigma 1119 1 ) 866 ice bucket suitable for liquid nitrogen, dry ice and acetone ( biochrom ) ( 4.5lit. ) 867 igepal ca630 ( sigma 18896 ) 868 insulin plain 28.7 iu / mg sigma 869 isopropyl alcohol 100% for molecular biology 870 isopropyl alcohol feisher 871 liquid nitrogen 872 mgmt antibody for western blot 873 milli q water 874 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 20 ml ) for keeping all molecular biology solutions and buffers 875 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 50 ml ) for keeping all molecular biology solutions and buffers 876 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 100 ml ) for keeping all molecular biology solutions and buffers 877 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 250 ml ) for keeping all molecular biology solutions and buffers 878 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 500 ml ) for keeping all molecular biology solutions and buffers 879 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 1000 ml ) for keeping all molecular biology solutions and buffers 880 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 2 ltrs ) for keeping all molecular biology solutions and buffers 881 molecular biology reagent bottles – wide mouthed, autoclavable plastic screw capped glass bottles ( 4 ltrs ) for keeping all molecular biology solutions and buffers 882 n ethyl maleimide ( sigma e 3876 ) 883 n, n dimethyl p phenylenediamine dihydrochloride – sigma 884 naoh pellets ( vysis ) 885 nitroblue tetrazolium ( sigma n 6876 ) 886 nitrocellulose membrane sheet; 0.2μ; 7.9×10.5cm ) 887 pararosaline ( sigma p 1528 ) 888 pbs sachets to make i litre buffer 889 pcr buffer ( sigma aldrich ) 890 pcr purification kit ( 50 preps ) for purification of pcr products or dna fragments from enzymes, dntps, salts and primers without phenol / chloroform extraction using special silica based columns 891 pepsin p7000 892 primers for pcr 893 pronase ( sigma ) ( 10165921001 ) 894 protease type xxiv ( sigma p8038 ) 895 proteinase sigma 896 resorcinol 897 rhodanine stain – sigma 898 rna later 899 rubeanic acid– sigma 900 sample storage box for upto 3ml vials ( suitable up to at –190 c freezer ( biochrome ) 901 soluble blue ( methyl blue ) ( sigma code m. 6900 ) c.i. 42780 902 ssc 903 sucrose for molecular biology 904 sulpho salicylic acid ( sigma / merck ) 905 taq polymerase ( sigma / qiagen ) 5u / μl with 10x reaction buffer and mgcl2 906 temed for electrophoresis ( sigma aldrich ) 907 tris base for molecular biology, sigma 648310 908 tris glycine buffer: for western blot ( biorad ) 909 triton x 910 trizol tri reagent 911 tween 20 912 veronal buffer ( sodium acetate & sodium barbitone ) 913 victoria blue sigma 234176 914 viral rna extraction kit ( 50 preps ) for purification of viral rna from cell free samples such as plasma, serum, body fluid, urine, and cell culture supernatant one kit 915 kim wipes ( delicate ) 916 pepsin from porcine gastric mucosa sigma p7012 917 20x ssc ( nalgene abbott molecular ) 918 chloroform 919 thermonitrile gloves 920 isoamyl alcohol 921 phenol chloroform – isoamyl alcohol mixture ( 25:24:1 ) 922 chloroform – isoamyl alcohol mixture ( 24:1 ) 923 phenol 924 mgmt methylation kit 925 verso cdna synthesis kit thermofischer 926 tissue rna extraction kit qiagen 927 tissue dna extraction kit qiagen 928 dna extraction kit from whole blood 929 fast digest restriction enzyme fok1 930 pcr master mix 931 dna methylation kit 932 dna bisulphate modification for methylation specific reactions 933 serum micro rna isolation kit 934 micro rna cdna synthesis kit 935 guanidium thiocynate 936 random hexamer for rtpcr 937 oligo ( dt ) 18 primer for rtpcr 938 primers of 1000 base pairs 939 m mulv reverse transcriptase for rtpcr 940 50 base pair dna ladder 941 genomic dna purification kit for fresh and frozen blood / tissue 942 qiagen quick pcr purification kit 943 qiagen quick gel extraction kit 944 epigenetic dna methylation kit 945 sybr green mastermix for qpcr 946 6x loading dye for dna agarose electrophoresis 947 dna bisufite modification kit for methylation specific pcr tions ) 948 hot start taq dna polymer with 10x buffer without mgcl2 949 hot start pcr mastermix 950 sodium dodecyl suphate ( sds ) for mol. biology 951 beta mercaptoethanol 952 orthophenylene diamine sigma 953 diethyl pyrocarbonate ( depc ) 954 depc treated water 955 protein molecular weight marker low range 6500 66000 da 956 protein molecular weight marker medium range 36000 200000 da 957 protein molecular weight marker wide range 6500 2000000 da 958 bradford reagent 959 dmso for molecular biology 960 glycerol 961 rpmi – 1640 with l glutamine for cell culture powdered 962 rpmi – 1640 for cell culture tested ( liquid ) 963 rnase inhibitor 1000 u 964 10x tbe buffer 965 glacial acetic acid extrapure for molecular biology 966 tris chloride for molecular biology 967 tris buffer 968 bromophenol blue , sodium salt for molecular biology 969 ecl prime western blotting detection reagent 970 ecl prime blocking reagent 971 full range rainbow molecular weight 8000 220000 da marker 972 ecl dualvue western blotting markers 973 ammonium persulphate 974 dl nor leucin 975 hepes buffer 976 np 40 977 nitrocellulose membrane for western blotting 0.45 micron pore size 8.5×13cm. 978 albumin heat shock isolation ph 7.0 979 glacial acetic acid 100% for molecular biology, 980 acetyl thiocholine iodide a 5751 sigma 981 adenosine 5 triphosphate disodium salt ( sigma ) a 7699 982 adenosine tri phosphate 983 ambion nuclear free water 984 ammonium per sulphate: for electrophoresis ( sigma aldrich a 3678 ) 985 ana profile line blot assay for different nuclear antigens –sm, nrnp / sm, ssa, ssb, scl70, jo i, dsdna, nucleosomes, pm scl, histones ama, ribosome p protein, cenpb, ku, mi2 986 bactericidal, fungicidal, toberculocidal, virucidal against enveloped viruses ( including hbv, hiv, hcv ) , sars. also effective against adeno, papova and rota virus ( aldehyde free ) for surgical handwash 987 boats for making glass knives for electron microscopy imported 988 bone marrow aspiration needle 16g 989 bone marrow aspiration needle 18g 990 bone marrow trephine biopsy needle 12g 991 brilliant cresyl blue ( sigma ) 992 brilliant crystal scarlet ( acid red 44 ) ( sigma code c0644 ) c.i. 16250– 993 carbon steel razor blades single edge 0.09”thick for trimming –of em blocks 994 cardboard boxes matchbox style for labeling and storage of em blocks size 50x32x11mm, strong and rigid, covered with white paper both inside and outside 995 copper gilder grid ( 200mesh ) ( imported em grade ) 996 copper gilder grid ( 300mesh ) ( imported em grade ) 997 cryogenic apron 1.5 meter 998 n, n dimethyl p phenylenediamine dihydrochloride – sigma 999 ddsa ( imported em grade 1000 dental wax 1001 dibutyl phthalate ( imported em grade ) 1002 disodium hydrogen phosphate anhydrous 1003 disodium tetraborate 1004 dumont tweezer hp ss type 5 / 45 for em use ( imported em grade ) 1005 dumont tweezer ss am type 7 for em use ( imported em grade ) 1006 elisa kit for alternate complement pathway assay quantitative with 3 standards 1007 elisa kit for anti c3 nephritic factor quantitative with 3 standards 1008 elisa kit for anti dsdna quantitative with alteast three standards 1009 elisa kit for anti factor h for quantitative with 3 standards 1010 elisa kit for anti factor h variant for quantitative with 3 standards 1011 elisa kit for anti gbm antibody semi quantitative atleast three standards required 1012 elisa kit for anti lkm quantitative with alteast three standards 1013 elisa kit anti pr3 ( igg ) ( canca ) quantitative with alteast three standards 1014 elisa kit for anti mpo ( igg ) ( panca ) quantitative with alteast three standards 1015 elisa kit for bb complement factor quantitative with atleast 3 standards 1016 elisa kit for detection of calprotectin ( monoclonal antibody ) for quantitative with atleast three calibrators 1017 elisa kit for estimation of human adiponectin quantitative with atleast three standards 1018 elisa kit for estimation of human interleukin 10 quantitative – with atleast three standards 1019 elisa kit for estimation of human interleukin 18 quantitative –with atleast three standards 1020 elisa kit for estimation of human interleukin 6 quantitative with atleast three standards 1021 elisa kit for estimation of tnf alpha quantitative with atleast three standards 1022 elisa kit for il 15 quantitative with atleast three standards 1023 elisa kit for kim 1 quantitative with atleast three standards 1024 elisa kit for mmp9 quantitative with alteast three standards 1025 elisa kit for n acetyl b d glucosaminidase ( nag ) assay atleast three standards quantitative 1026 elisa kit for ngal ( neutrophil gelatinase associated lipocalin ) quantitative with 3 standards 1027 elisa kit for quantitative estimation of baff atleast three standards required 1028 elisa kit for quantitative estimation of ck18 m30 fragment atleast three standards required 1029 elisa kit for quantitative estimation of mcp 1 atleast three standards required 1030 elisa kit for quantitative estimation of tweak atleast three standards required 1031 epon 812 ( imported em grade ) 1032 epoxy resin cy212 ( imported em grade ) 1033 ethanol 100% for molecular biology 1034 ethanol 200 proof for em processing ( fiescher ) 1035 ficoll ( sigma ) 1036 fish probe cdkn2a / cep9 fish probe kit 1037 fish probe 1p36 / 1q25 and 19p13 / 19q13q probe for fish 1038 fish probe egfr / cep7 fish probe kit 1039 fish probe her2 / neu probe for fish analysis 1040 fish probe lsi tp53 / cep 17 fish probe kit 1041 fish probe pten. cep 10 fish probe kit 1042 fish probe for pdgfr 1043 fish probe for ewsr1 break apart dual colour probe 1044 fish probe for tert / 5q31 dual colour probe 1045 fish probe for nmyc 1046 break apart fish probe for braf 1047 break apart fish probe for rela 1048 fish probe for myc ( 8q24 ) break apart probe orange / green 1049 fish probe for c19mc / tpm4 fish probe kit 1050 fish / cish probe for bond eber probe ( preferably leica ) rtu ) 1051 fitc conjugated anti albumin conc 1052 fitc conjugated anti c3 conc 1053 fitc conjugated anti igg conc 1054 fitc conjugated anti fibrinogen conc 1055 fitc conjugated anti iga conc 1056 fitc conjugated anti igm conc 1057 fitc conjugated anti kappa – antibody conc 1058 fitc conjugated anti lambda antibody conc 1059 fitc conjugated clq conc 1060 fitc conjugated mouse monoclonal anti human iggl ( fc ) 1061 fitc labeled anti human igg3 ( f ( ab’ ) 2 ) 1062 fitc labeled anti human igg2 ( fab ) 1063 fitc labeled anti human igg4 ( pfc’ ) 1064 fitc labeled rabbit anti mouse igg ( secondary ab ) 1065 fluorescence mounting medium 1066 formaldehyde 16% em grade 1067 glass graduated centrifuged test tubes 15 ml vol with conical base 1068 gluraldehyde 25% em grade ( imported em grade ) 1069 humphys knife disposable 1070 ifa for differentiation of antibodies against cell nuclei ( ana ) hep2 cells 1071 ifa kit against liver antigens containing hep2, primate liver, rat kidney, rat liver, rat stomach, vsm 47 16tests 1072 igepal ca630 sigma 1073 immunofluorescence kit – mosaic profile three of multibiochips for doing ana ( multibiochips of hep 2 cells, rat stomach, primate liver, rat kidney ) 1074 imported diatome diamond knife for ultra thin sectioning3.5 mm 45 degrees cutting angle for electron microscopy 1075 ifa kit for cns profile with 12 antigens 1076 ifa kit for git profile with 9 antigens 1077 kit for occult blood in stool. 1078 lead citrate for em 1079 line immunoassay for anca ( c&p ) and antigbm antibody 1080 line immunoassay for detection of antibodies against neuronal antigens including amphiphysin, cv2, pnma2, ri, yo, hu, recoverin, sox1, titin for detection of paraneoplastic syndromes 1081 line immunoassay for detection of igg antibodies against neuronal antigens gm1, gm2, gm3, gd1a, gd1b, gt1b, gq1b for detection of inflammatory peripheral neuropathies 1082 line immunoassay for detection of igm antibodies against neuronal antigens gm1, gm2, gm3, gd1a, gd1b, gt1b, gq1b for detection of inflammatory peripheral neuropathies 1083 liver profile with 7 antigens line immunoassay 1084 mgmt antibody for western blot 1085 microplate elisa for determination of autoantibodies against cyclic citrullinated peptide ( ccp ) . igg 1086 microplate elisa for determination of autoantibodies against cyclic citrullinated peptide ( ccp ) . iga 1087 mouse anti human amyloid a kit for immunofluorescence on frozen tissues 1088 mouse monoclonal anti human c4d antibody kit for immunofluorescence on frozen tissues 1089 nma for em processing ( imported em grade ) 1090 fecal occult blood test ( fobt ) , preferably beckman coulter 1091 osmium tetra oxide ( imported em grade 2% solution 1092 poly bed resin ( epon ) ( imported em grade ) 1093 proteinase k ( sigma p2308 ) 1094 propylene oxide for electron microscopy imported 1095 resin kit for araldite em embedding 1096 resin kit for epon embedding for electron microscopy imported 1097 sample storage box for upto 3ml vials ( suitable up to at –190 c freezer ( biochrome ) 1098 sodium cacodylate ( imported em grade ) 1099 soluble blue ( methyl blue ) ( sigma code m. 6900 ) c.i. 42780 1100 ssc 1101 sucrose ( imported em grade ) 1102 sulpho salicylic acid ( sigma / merck ) 1103 symcollidine buffer ampoule ( imported em grade ) 1104 titre plane technology based on a biochip of primate liver and gliadin to test for anti endomysial and gliadin antibodies by indirect immunofluorescence 1105 titre plane technology based on a biochip to test for antibody against pla2r for primary glomerulonephritis by indirect immunofluorescence 1106 titre plane technology based on a biochip to test for neuromyelitis optica 1107 uranyl acetate ( imported em grade ) 1108 veronal buffer saline 1109 victoria blue sigma 234176 1110 quantitative elisa kit for kim1 for 96 well with minimum 3 standards 1111 quantitative elisa kit for human il 2 opt elisa kit ii for 96 wells with minimum 3 standards 1112 osmium tetraoxide ( crystal ) em grade 1 / 4 gm crystal 1113 fomvar coated copper grids ( single slot ) em grade 2*1mm 1114 flat embedding molds em grade 20 numbered cavities measures: 14mm ( l ) x5mm ( w ) x 4 6mm ( d ) . 1115 beem capsule molds type a: 10 cavities, 8mm diameter body, 5mm diameter tip, 11mm height, tapered tip. 1116 perfect loop for em 1117 grid box for em 1118 cellulose filter 0.22ml ( 3mm ) for em 1119 millipore syringe filter 0.22ml ( 33mm ) for em 1120 glass knive holder for em 1121 copper grids ( 100 mesh ) em grade 1122 glass strips for making glass knives for em 400x25x6.4mm 1123 50% glutaraldehyde em grade glass ampoule of 10ml 1124 tris base sigma 648310 1125 quantitative elisa kit for alport syndrome kit for 96 well with minimum 3 standard 1126 fitc labelled anti eber antibody kit for 40 tests 1127 new methylene blue for reticulin stain sigma 1128 quenching solution for fish 1129 fish tissue kit ( zytovision ) 1130 fast hybridisation buffer 1131 fine brushes for cryostat ( no 2 ) leica animal hair 1132 cryoembedding compound leica / thermo fischer 1133 elisa kit for quantitative assessment of pla2r antibodies with minimum 3 standards 1134 human complement system screen kit 1135 human terminal complement complex ( tcc ) elisa kit ( sc5b 9 ) 1136 human complement factor d elisa kit 1137 human complement factor h elisa kit 1138 human complement pan specific c3 reagent kit 1139 ba enzyme immunoassay elisa kit 1140 c4a enzyme immunoassay elisa kit 1141 c4d enzyme immunoassay elisa kit 1142 c3a plus eia elisa kit 1143 ic3b eia enzyme immunoassay elisa kit 1144 c5a enzyme immunoassay elisa kit 1145 bb enzyme immunoassay elisa kit 1146 c1 inhibitor plus enzyme immunoassay elisa kit 1147 ch50 eq eia elisa kit 1148 factor h y402h variant detection elisa kit 1149 h ficolin human elisa kit 1150 l ficolin human elisa kit 1151 masp 2 human elisa kit 1152 masp 3 human elisa kit 1153 mbl human elisa kit 1154 mbl / masp human elisa kit 1155 sp human elisa kit 1156 anti hcd3 pe ( clone ucht1 / or clone hit3a ) for flow cytometry 1157 anti hcd4 fitc ( clone tt1 ( drfz ) or clone okt4 for flow cytometry 1158 anti hcd8 pe for flow cytometry 1159 anti hcd14 for flow cytometry 1160 anti hcd19 for flow cytometry 1161 anti hcd25 treg for flow cytometry 1162 elisa kit to measure cardiolipin ( igg ) 1163 elisa kit to measure cardiolipin ( igm ) 1164 elisa kit to measure b2 glycoprotein ( igg ) 1165 elisa kit to measure b2 glycoprotein ( igm ) 1166 elisa kit to measure phosphatidylserine ( igg ) 1167 elisa kit to measure phosphatidylserine ( igm ) 1168 rubeanic acid– sigma 1169 sirius red / direct red 80 – sigma 365548 1170 tris glycine buffer : for western blot ( biorad ) 1171 dewax & hier buffer low 1172 dewax & hier buffer high 1173 op quanto antibody diluent 1174 tween 20 1175 ultravision quanto detection 1176 abx diluent ( horiba, model pentra xlr ) 1177 abx basolyse ( horiba, model pentra xlr ) 1178 abx cleaner ( horiba, model pentra xlr ) 1179 abx eosinofix ( horiba, model pentra xlr ) 1180 abx lysebio ii ( horiba, model pentra xlr ) 1181 abx difftrol ( low, normal, high ) ( horiba, model pentra xlr ) 1182 abx minoclair ( horiba, model pentra xlr ) 1183 cell pack ( transasia, model no xt2000i ) 1184 stromatolyser 4dl ( transasia, model no xt2000i ) 1185 stromatolyser fb ( transasia, model no xt2000i ) 1186 stromatolyser 4ds ( transasia, model no xt2000i ) 1187 sulfolyser ( transasia, model no xt2000i ) 1188 cell clean ( transasia, model no xt2000i ) 1189 ret search ii ( transasia, model no xt2000i ) 1190 e check control low, normal, high ( transasia, model no t2000i ) 1191 human beta 2 microglobulin antiserum ( mininephplus, model ad 500 ) 1192 human c3kit ( mininephplus, model ad 500 ) 1193 human c4 kit ( mininephplus, model ad 500 ) 1194 human caeruloplasmin antiserum ( mininephplus, model ad 500 ) 1195 human iga kit ( mininephplus, model ad 500 ) 1196 human igg1 kit ( mininephplus, model ad 500 ) 1197 human igg2 kit ( mininephplus, model ad 500 ) 1198 human igg3 latex kit ( mininephplus, model ad 500 ) 1199 human igg4 latex kit ( mininephplus, model ad 500 ) 1200 human igm kit ( mininephplus, model ad 500 ) 1201 human microalbumin antiserum ( mininephplus, model ad 500 ) 1202 human prealbumin kit ( mininephplus, model ad 500 ) 1203 human rheumatoid factor latex kit ( mininephplus, model ad 500 ) 1204 human transferrin antiserum ( mininephplus, model ad 500 ) 1205 reagent accessory pack ( mininephplus, model ad 500 ) 1206 sample diluents pack ( mininephplus, model ad 500 ) 1207 on board buffer 1208 on board buffer 1209 scs 1000 caliberator 1210 anti hu ( anna 1 ) 1211 anti yo ( pca 1 ) 1212 anti pca 2 1213 anti pca tr 1214 anti ri ( anna 2 1215 anna 3 1216 agna 1 1217 anti tr 1218 anti cv2 / crmp5: 1219 anti vgcc : 1220 anti aquaporin 4 1221 anti mog antibody: 1222 anti ganglionic acetylcholine receptor antibody 1223 dopamine 2 receptor antibody 1224 gaba b receptor antibody 1225 anti gm1, gd1b ( igm ) : 1226 anti gm2 ( igm ) 1227 anti gm1a, gm1b gd1a, 1228 galnacgd1a, ( igg ) 1229 anti gq1b, gt1a 1230 anti gd3, gd1b 1231 anti gd1b and other disialylated 1232 anti mag ( igm ) 1233 fish probe ss18 gene 1234 xl ewsr1 ba: d 6011 100 og 1235 pax 6 1236 nf h, m ( non phosphorylated ) 1237 cd 133 1238 nestin 1239 il6 1240 tnfx...

Department Of Biotechnology - Delhi

21658937 supply of laboratory plastic ware ( bulk requirement ) : 1 cell culture flasks, 25 cm2, angled neck, cap ( phenolic style ) 2 cell culture flasks, 25 cm2, canted neck, cap ( vented ) 3 cell culture flask, 25cm² rectangular, canted neck, vented cap 4 cell culture flask, 75cm² rectangular, canted neck, vented cap 5 75 cm² u shape cell culture flask, canted neck, plug seal cap, sterile, tissue culture treated 6 75 cm² u shape cell culture flask, canted neck, vent cap, sterile, tissue culture treated 7 cell culture flasks, surface area 150 cm2, canted neck, cap ( phenolic style ) 8 cell culture flasks, surface area 150 cm2, canted neck, cap ( vented ) 9 tissue culture dish, tc treated ( 35x10 mm ) , sterile 10 tissue culture dish, tc treated ( 60x15 mm ) , sterile 11 tissue culture dish, tc treated ( 100x20 mm ) , sterile 12 tissue culture dish, tc treated ( 150x25 mm ) , sterile 13 cell culture dish, non treated polystyrene ( 100x20mm ) , sterile, for suspension cells, vented 14 sterile 35 x 10mm vented cell culture dishes, petri dish style, non treated polystyrene 15 sterile 60 x 15mm vented cell culture dishes, petri dish style, non treated polystyrene 16 tc treated multiple well plates, 6 wells, clear polystyrene, flat bottom, sterile, lid 17 tc treated multiple well plates, 12 wells, clear polystyrene, flat bottom, sterile, lid 18 tc treated multiple well plates, 24 wells, clear polystyrene, flat bottom, sterile, lid 19 tc treated multiple well plates, 48 wells, clear polystyrene, flat bottom, sterile, lid 20 petri dishes, 90 mm, with vent, radiation sterile 21 petri dishes, 150 mm, with vent, radiation sterile 22 serological pipettes 1 ml, sterile, individually wrapped 23 serological pipettes 2 ml, sterile, individually wrapped 24 serological pipettes 5 ml, sterile, individually wrapped 25 serological pipettes 10 ml, sterile, individually wrapped 26 serological pipettes 25 ml, sterile, individually wrapped 27 serological pipettes 50 ml, sterile, individually wrapped 28 centrifuge tubes, polypropylene, sterile, 15 ml 29 centrifuge tubes, polypropylene, sterile, 50 ml 30 snap cap tubes, polystyrene, round bottomed, 5 ml, sterile 31 snap cap tubes, polystyrene, round bottomed, 14 ml, sterile 32 tips 10ul ( for p2 p10 ) 33 tips 200ul ( yellow for p20 p200 ) 34 tips 1000ul ( blue for p1000 ) 35 micro centrifuge tubes 0.5 ml 36 micro centrifuge tubes 1.5 / 1.7 ml 37 micro centrifuge tubes 2 ml 38 pcr tubes 0.2 ml, flat cap, dnase rnase free 39 storage vials ( cryo vials ) 1.8 2ml, sterile 40 cell scrapers 25 28 cm handle, sterile, individually wrapped 41 cell scrapers 40 cm handle, sterile, individually wrapped 42 syringe filters, 4mm, 0.22 μm, pvdf, sterile 43 syringe filters, 13mm, 0.22 μm, pvdf, sterile 44 syringe filters, 25mm, 0.22 μm, pvdf, sterile 45 syringe filters, 33mm, 0.22 μm, pvdf, sterile 46 cell strainer 40 μm / blue, for use w / 50ml conical tubes, sterile 47 cell strainer 70 μm / white, for use w / 50ml conical tubes, sterile 48 cell strainer 100 μm / yellow, for use w / 50ml conical tubes, sterile 49 filter tips with rack ( 0.5 10μl ) , pre sterlized, ultra low retention 50 filter tips with rack ( 1 20μl ) , pre sterlized ultra low retention 51 filter tips with rack ( 1 200μl ) , pre sterlized ultra low retention 52 filter tips with rack ( 100 1000μl ) , pre sterlized ultra low retention 53 high binding 96 well elisa plates 54 bottle top filter 0.20 micron, sterile, disposable 55 96 well polypropylene cluster tubes, individual tube format, nonsterile, without rack 56 no cap tubes, polystyrene, round bottom, 5ml 57 96 well plates 1 / pk ( round bottom ) 58 300 ul ultra low retention filter pipet tip refill 59 1000 ul ultra low retention filter pipet tip refill 60 96 well polystyrene flat bottom cell culture microplate, black 61 cell culture flask, t 25, filter cap, non treated 62 cell culture flask, t 75, filter cap, non treated 63 cell culture flask, t 175, filter cap, non treated 64 cell culture flask, t 25, filter cap, tc treated 65 cell culture plate, 6 well, non treated 66 cell culture plate, 12 well, non treated 67 cell culture plate, 24 well, non treated 68 cell culture plate, 48 well, non treated 69 cell culture plate, 96 well, non treated...

Delhi University - Delhi

21010580 supply of plastic ware 01. serological pipette 10 ml ( tarsons ) 02. presterilized syringe filters 0.2 micron ( mdi ) 03. tissue culture plate 96 well flat bottom ( nest ) 04. micro tips 2 200μl ( tarsons ) 05. micro tips 200 1000μl ( tarsons ) 06. tarsons tissue culture flask t25 with filter cap quantity : 2=> open tender...

Defence Research And Development Organisation - Delhi

20719478 supply of nickel moleculor biology 99 percent mol and 57 other items=> limited: 27 precision plus protein dual xtra standards ( 1pack=500ul ) 28 bovine albumin fraction v ( cas no.9048 46 8 ) ( 1pack=100gm ) 29 ammonium persulphate for molecular biology ( cas no.7727 54 0 ) ( 1pack=100gm ) 30 n, n, n, n tetramethyl ethylenediamine ( temed ) for molecular biology, 99.5% ( cas no.110 18 9 ) ( 1pack=250ml ) 31 potassium dihydrogen orthophosphate for molecular biology, 99.5% ( cas no.7778 77 0 ) ( 1pack=500gm ) 32 syringe filter durapore pvdf ( 1pack=250piece ) 33 deoxycholic acid, sodium salt molecular grade ( cas no.302 95 4 ) ( pack size=100gm ) 34 hcl molecular grade 37% ( pack size=1l ) 35 protease inhibitor ( cocktail ) ( 1pack= 5 ml ) 36 phenylmethylsulfonyl fluoride ( cas no.329 98 6 ) ( pack size=100gm ) 37 sodium fluoride , acs ( cas no.7681 49 4 ) ( pack size=100gm ) 38 sodium ortho vanadate molecular grade ( cas no.13721 39 8 ) ( pack size=100gm ) 39 boric acid molecular grade ( cas no.10043 35 3 ) ( pack size=1kg ) 40 formal dehyde acs ( cas no. 50 00 0 ) ( pack size=500ml ) 41 formalin solution 10% for histology ( pack size=4l ) 42 sodium dodecyl sulphate molecular biology grade ( cas no.151 21 3 ) ( pack size=500gm ) 43 super script iii reverse transcriptase molecular biology grade ( 1pack= 10000 u ) 44 red taq ready mix pcr reaction mix molecular biology grade ( 1pack= 100rxn ) 45 20bps molecular weight marker molecular biology grade ( 1pack=250ul ) 46 ethanol ( molecular grade ) ( cas no.64 17 5 ) ( 1pack=1ltr ) 47 nitrocellulose membrane0.45um roll 30cmx3.5m ( 1pack=1roll ) 48 immobilon nitrocellulose membrane 0.2um roll 30cmx3.5m ( 1pack = 1roll ) 49 immobilon pvdf membrane 0.45um roll 26.5x3.75m ( 1pack = 1roll ) 50 immobilon pvdf membrane 0.2um roll 26cmx3.3m ( 1pack = 1roll ) 51 tris hydrochloride molecular grade mol weight 157.60 ( cas no.1185 53 1 ) ( 1pack = 1kg ) 52 glysine molecular grade ( 1pack = 1kg ) 53 acrylamide molecular grade ( cas no.79 06 1 ) ( 1pack = 1kg ) ...

Ministry Of Health And Family Welfare - Delhi

20088359 purchase of plastic wares/glass wares 78 plastic dropper disposable sterilized i. 1ml (individually packed) ii. 3ml(individually packed) 79 eppendorf 1.8ml 80 sterile cryo vials tissue culture grade (1.5ml) individually packed 81.(i) bottles with screw cap 250ml (ii) 500ml 82 vacutainer tubes plain 83 sterile cotton swab with wooden stick 84 micro pipette stand 85(i) stands for eppendorf tube 1.5ml ii. 0.5ml 86 screw capped borosilicate glass tissue culture tubes 15 ml, round bottom, size: 100mm x 13 mm 87(i) disposable sterilized syringe filter 0.22um (ii) 0.45 um 88 syringe filter 89 plastic vertical coupling jar 90 glass coupling jar horizontal 91(i) discarding bags (big size) (0.05mm thick, polypropylene) red ii blue iii black iv yellow 92(i) discarding bags (small size) red ii blue iii black iv yellow 93(i) discarding bags (medium)red (ii) blue (iii) green 94 parafilm roll 95 microfuge (0.5ml) cryoboxes capacity 96 96 thermometers(0◦ 100 deg c) 97 thermometers(0◦ 110 c) 98 disposable syringe with needle (1ml) 99(i) funnel glass 3 (ii) 4 (iii) 100 ml 100 (i) sample bottle screw capped 10 ml (ii) 20 ml 101(i) poly propene botles (autoclavable) 1 ltr (ii) poly propene botles (autoclavable) 250ml 102 microscopic glass slide 75 mmx25mmx1.25mm 103(i) microscopic slide size76x26mm (ii) 25.4mmx76.2x1.0 1.2mm) 104 conical flask 3 ltr 105 (i) surgical gloves (7.5 no) (ii) 7 (iii) 6 106 micros. glass slide(blue star)(sz1x3&1mm 2mmthick) 107 micro pipette 50ul 108(i) test tubes 15x150cm (ii) test tubes 12x150cm (iii) test tubes 12x125cm (iv) test tubes 12x100cm (v) test tube 20 ml 109 eppendrof tubes (1.5ml) (polypropylene, conical,autoclavable with internal graduation. can withstand 20000 rcf,rnas/dnase/endotoxin free, with frosted side panel for making) 110 sterile 96 wells microplates(u well format) 111(i) discarding glass jar with lead (5 ltr) (ii) discarding glass jar with lead (2 ltr)...

Defence Research And Development Organisation - Delhi

19838947 supply of apc anti human cd184 and 22 other items: 1 apc anti human cd184 ( 1 pk=100 tests ) 2 apc anti mouse cd48 ( 1 pk=100 ug ) 3 alexa fluor 647 anti mouse cd150 ( 1 pk=100 ug ) 4 anti mouse cd48 apc tagged ( 1 pk=100 ug ) 5 pe anti mouse cd201 ( 1 pk= 100 ug ) 6 alexa fluor 647 anti mouse cd73 ( 1 pk=100 ug ) 7 transwell cell culture inserts ( 1 pk=12 ) 8 membrane filters ( 0.45 u; 1 pk=100 discs ) 9 pvdf syringe filters ( 0.22 u;1 pk=100 ) 10 fluoro 4am cell permeant ( 10 x50 ug ) 11 bapta am cell permeant ( 1 pk= 20x1 mg ) 12 amd 3100 octahydrichloride hydrate ( 1 pk=5 mg ) 13 recombinanat mouse sdf1 protein ( 1 pk=2 ug ) 14 chemiluminescent substrate ( 1 pk= 20 ml ) 15 click it plus opp alexa fluor 488 protein synthesis kit ( 1 pk= 1kit ) 16 opp ( o propargyl puromycin ) ( 1 pk=5 mg ) 17 apc anti mouse / human cd44 ( 1 pk=100 ug ) 18 pe anti mouse cd105 ( 1 pk=100 ug ) 19 fitc anti mouse cd21 / cd35 ( 1 pk= 100 ug ) 20 percp anti mouse cd45 ( 1 pk=100 ug ) 21 c6 flow cytometer maintenanace kit ( 1 kit= for 1 year ) 22 c6 flow cytometer fluid kit ( 1 pk=1 ) 23 fitc anti mouse lineage cocktail with isotype controls ( 1 pk=100 tests ) => limited...

National Institute Of Health And Family Welfare - Delhi

18529800 tender for supply of laboratory sundries items : glasswares 1 beakers 25ml, 50 ml , 100 ml, 250 ml, 500 ml, 1000 ml 2 beakers 2000 ml 3 beakers 5000 ml 4 bottles 100 ml, 250 ml 5 bottles 500 ml, 1000 ml 6 conical flask 500 ml ( three neck ) 7 conical flask 2000 ml ( two neck ) 8 calibrated glass pipettes 1 ml, 5 ml, 10 ml 9 pasteur pipettes 10 distillation plant flask 5 lit 11 tlc capillary 12 mice bleeding capillary heparinized 13 rat bleeding heparinized capillary plasticwares / teflon / latex 14 96 stripwell high binding microplate ( 92592 ) 15 protein a ceramic hyper d f, pearl ( 2007 / 8 c001 ) 16 double layer syringe filter pes+ gf 0.2μm, 33 mm 17 double layer syringe filter pes+ gf 0.45μm, 33 mm 18 dropper 25μl drop size 19 dropper 5μl drop size 20 dropper 30μl drop size 21 buffer vial 5ml 22 buffer vial 3ml 23 buffer vial 10ml 24 buffer vial 50ml 25 magnetic bars teflon coated ( min. small 5mm, small 1” , medium 2”, large3’ ) 26 dialysis tube avg. flat width 35 mm, mwco 12, 000 da ( 1.4 in ) , 27 poly gloves hand care 1 non sterile, small, large 2 sterile, small, large 28 glass slides 29 cover slip 30 pcr tube ( 0.2 flat cap ) pcr 02 c 31 autoclave tips ( 0.5 10ul ) t 300l 32 autoclave tips ( 100ul ) tgl 200 r 33 labtags ( 38mmx6.5mm ) pg lt 38 / y 34 syringe dispovan 1ml 35 syringe dispovan 2 ml 36 syringe dispovan 10 ml 37 syringe dispovan 20 ml 38 needle no.26 39 needle no.18 40 needle no.20 41 needle no 22 42 tissue paper 100 mtr. 43 cotton roll 44 abrotape 1” size 45 aluminum foil good quality and thick, research grade 46 foot pad bio waste dustbin three color ( red, yellow, black ) 47 bio waste dustbin poly bag three color ( red, yellow, black ) 48 flip poly bag ( 5x7” ) 49 dustbin polythene ( black ) 50 stainless steel cutter ( large ) 51 stainless steel scale 52 band aid ( water proof ) 53 dettol hand wash liquid ( riffled pack ) 54 figaro olive oil 55 7’oclock blade 56 fin pipette set of 1 10μl, 10 100 μl, 100 1000 μl, ...

Indian Council Of Medical Research - Delhi

18311312 tender for quotation for supply of laboratory chemicals/ monoclonal antibodies/kits! primers/ lab. plasticware, etc. aec mountant connexin 43 smooth muscle actin connexin 40 n cadherin tnf alpha fibronectin serological pipettes 1 ml serological pipettes 2 ml serological pipettes 5 ml serological pipettes 10 ml , cell culture dish. 1oox2omm 6 well culture plate, tc treated microcentrifugc tubes l.7ml dmem media antibiotic antirnycotic solution pbs. ph7.4 ix falcon tube 15 ml falcon tube 50 ml microtip 1oul microtip 200u1 microtip 1000ul syringe filter, 0.22 urn syringe filter, 0.45urn , immuno non sterile 96 well plates taqman gene expression assay (fam) fetal bovine serum lrypsin edta clandin 4 antibody (monoclonal) 50x taf buffer, ultra pure grade lox vibuffera 50mm mgci2 10mm dntp mix gf 1 tissue dna extraction kit viprime plus gpcr master mix with rox cdna synthesis kit ehedium bromide hi g9 tag dna polymerase 6x gel loading dye 2x rna gel loading dye sodium dodecyl sulläte hi grade nuclease free water 5’ cagggtggtgctccaaattac 3’ catalase f 5’gtgttgaatctccgcacttctc 3’ catakase r 5q ggactacacccagatgaacga 3’gpxi f ’ gttctcctgatgcccaaactg 3’ gpxi r 5’ cggccttctgttcctgataaa 3’ mmpi4 f 5’ cgctccttgaagacaaacatctc 3’ mmp14 r 5’ acgccagctaagcatagtaaga 3’ timp2 f 5’ (itcctggaggctgagaaagaa 3’ timp2 r hs mir 873sp miscript primer assay hs mir 223.3p miscript primer assay hs mir 517a 3p miscript primer say ftd std9 kit trizol reagent trizol ls rna latter 3m sodium acetate kimberly..clark* purple nitrile * (smajlj kjmiierly...clark* purple n1trile * (smalj) glycerol for molecular biology pmsf art 10 bulk...

Chacha Nehru Bal Chikitsalaya - Delhi

17676737 tender for glassware and plastic ware items : 344 sterile cotton swab w / wooden stick, size 150 x 2.5 mm individually packed pack of 500 swabs 345 sterile nylon swab with flexible stick ( with pint to break ) for nasopharyngeal specimens ) , individually packed 346 sterilisable and reusable stoppers made of cellulose for test tubes size 15mm 347 sterilisable and reusable stoppers made of cellulose for conical flasks size 1000ml 348 sterilisable and reusable stoppers made of cellulose for conical flasks size 500ml 349 sterilisable and reusable stoppers made of cellulose for test tubes size 18mm 350 sterilisable and reusable stoppers made of cellulose for test tubes size 25mm 351 stop watch352 storage boxes polycarbonate boxes that can withhold 100degreesc to +121degreesc, quoted with all colours clearly mentioned, should have transparent hinged lid with built in stop with forward slope base, should be stackable and should be autoclaveable. 353 storage vials screw capped, autoclavable with rubber liner, 3ml 354 syringe filter disposable, 0.22 micrometer pore size filter, presterilised 355 syringe filters nylon, 25mm, 0.2mcm pore size ( pp ) , presterilised 356 syringe filters nylon, 25mm, 0.45mcm pore size ( pp ) , presterilised 357 syringe filters reusable, polypropylene housing, teflon ptfe membrane, autoclavable, for 25mm filter, pore size 0.2mcm 358 syringe filters reusable, polypropylene housing, teflon ptfe membrane, autoclavable, for 25mm filter, pore size 0.45mcm 359 syringe filters reusable, stainless steel, autoclavable, for 25mm filter 360 test tube boroslicate glass, round bottom, 12x75m 361 test tube polypropylene, pre sterilised 12x75m 362 test tube without rim 12x100mm 363 test tube basket material pp, autoclavable, 22x22x22cm with lid 364 test tube stand / racks stainless steel, should hold atleast 40 tubes of 2.5cm diameter...

G B Pant Hospital - Delhi

17057038 supply of chemical kits and glassware items for microbiology 241. liquid paraffin 242. linezolid 3omcg disc 243. low temp. catalyst (oxoid) br, 0042 a 244. loop handle 245. lysine hydrochoride 246. mac conkey agar m 0082 247. maltose (anatar grade) 248. maltose disc 249. malaria antigen kit 250. mannitol (disc) i. mannitol powder 252. mannitol salt agar 253. mannose disc 254. mannose powder 255. marking pen 256. meropenem disc 10 mcgt 257. melibiose powder rm 106 258. melibiose disc 259. malachite green powder 260. metallo beta lactamase e strips — 261. methyl alcohol 262. methyl red reagent powder 263. methyl blue powder 264. metronidazole disc 5mcg 265. micropipettes variable volume. 266. micropipettes variable volume. 267. micropipcttes variable volume. 268. microplate elisa for determination of auto antibodies against cyclic citrulinatcd peptide (ccp) 269. micropipette multichannel 8 channel volume 270. microplate elisa for pre differentiation of antibodies against cell nuclei (ana) & cytoplasm components 271. microwell elisa plate flat bottom made of polystyrene 272. microwell elisa plate flat bottom made of polypropylene 273. microwell elisa plate flat bottom made of polystyrene (autoclavable) 274. microwell elisa plate flat bottom made of polypropylene (autoclavable) 275. fluorescent microscope immersion oil 276. moxifloxacin discs, 5 meg 277. mueller hinton agar 27w mueller hinton broth 279. millipore syringe filter (22 micron) 280. mupirocin disc 5 mcg 281. metaloop — sl, fixed straight nichrome wire embedded in s.s. rod with heat resistant handle with 4 mm diameter, calibrated 0.01 ml. 282. naldixic acid disc (30 meg) 283. ncomycin disc 30mcg 284. netilmicin disc (3omcg) 285. neutral_red_powder 286. nichrome wire straight 287. nitrofuradantin disc loomcg 288. nitrocetin (oxoid) 289. norfloxacin disc (lomeg)...

Delhi University - Delhi

16736348 supply of plastic ware 6 well plate (corning) ,10 ml serological pipettes (corning) , syringe filters...

Delhi University - Delhi

16435261 supply of plasticware 1. 6 well plate ( corning ) 2. 10 ml serological pipettes ( corning ) 3 syringe filters...

Defence Research And Development Organisation - Delhi

11194291 supply of plastic ware 1 tips 1000 ul ( blue ) 2 tips 200 ul ( yellow ) 3 tips 10 ul ( neutral ) 4 parafilm 4’’ x125’ 5 cell and tissue culture flask, 50ml, sterile, cap style vent 6 cell and tissue culture flask, 250ml, sterile, cap style vent 7 cell and tissue culture flask, 750ml, sterile, cap style vent 8 1.5ml micro centrifuge tubes 9 2 .0ml micro centrifuge tubes 10 0.5 ml micro centrifuge tubes 11 pcr tubes, sterile, flat cap 12 corning plates 96 well transparent bottom with lid 13 96 well assay plates 14 syringe filter 0. 22 micron, 33mm disc 15 syringe filter 0. 22 micron, 13mm disc 16 nitrile gloves ( sizes s ) 17 nitrile gloves ( sizes m ) 18 syringes 5ml 19 syringes 1ml 20 syringes 2ml 21 syringes 10ml 22 pcr rack 23 15 ml conical bottomed tubes with cap 24 50 ml conical bottomed tubes with cap 25 wide mouth bottle ( 125ml ) 26 wide mouth bottle ( 250ml ) 27 wide mouth bottle ( 500ml ) 28 wide mouth bottle ( 1000ml ) 29 reversible rack with cover ( 96 places ) 30 filter tips 100 1000μl sterile, nonpyrogenic, dnase , rnase, protease free sterile, nonpyrogenic 31 filter tips 02 200μl sterile, nonpyrogenic, dnase , rnase, protease free sterile, nonpyrogenic 32 filter tips 0.1 20μl sterile, nonpyrogenic, dnase , rnase, protease free sterile 33 amber wide mouth bottle250ml 34 amber wide mouth bottle 125ml 35 amber wide mouth bottle 60ml 36 amber wide mouth bottle 30ml 37 wide mouth wash bottle 500ml 38 wide mouth wash bottle 250ml 39 cryo tag 38x19mm ( 1000 / case ) 40 tough spots , dia 9.5mm ( 1000 / case ) 41 nitrocellulose membrane 0.20micron, 42 35 x 10 mm easy grip polystyrene tc treated cell culture dish, sterile 43 60 x 15 mm standard polystrene tc treated cell culture dish 44 100 x 20 mm standard polystrene tc treated cell culture dish 45 cell scrapers with 25 cm polystyrene handle and 3.0 cm blade 46 single channel pipettor, 10 100 ul autoclave 47 1 ml polystyrene serological pipet, 1 / 100 increments, individually packed 48 2 ml polystyrene serological pipet, 1 / 100 increments, individually packed 49 5 ml polystyrene serological pipet, 1 / 10 increments, individually packed 50 10 ml polystyrene serological pipet, 1 / 10 increments, individually packed 51 parafilm dispenser => limited tender...

Indian Council Of Medical Research - Delhi

8757635 tender for supply of chemicals, consumables, glasswares and plasticware etc., rate contract 1 1 ­‐naphthyl acetate 2 1, 4 dioxane 3 100bp ladder marker upto 5kba 4 100bp dna ladder 5 100bp ladder, 1kb ladder 6 100g o ­‐phenylenediamine 7 10x tbs buffer 8 10x te 9 1kb dna ladder 10 20 bp dna ladder 11 20 bp ladder marker 12 2 ­‐mercaptoethanol 13 2 ­‐naphthyl acetate 14 3100 pop ­‐6 ea15 3730 buffer 10x with edta, 500 ml 16 50bp dna ladder 17 6x dna loading dye 18 6x loading buffer 19 6x loading buffer &dye 20 6x loadingbuffer, 15% ficoll 21 acd3 purified 145 ­‐2c11 22 acetone 500ml emplura merck 23 afl iii 24 afl ­‐iii ­‐1000unit 25 agarose 26 agarose low eeo 100g 27 agarose, 1kg 28 albumin 29 alkaline phospahate 30 amber centrifuge tube conical bottom ( 15ml ) 31 amber centrifuge tube conical bottom ( 50ml ) 32 ammonium ­‐bt carbonate 33 anti gadph 34 anti human cd3 zeta chain 35 anti ­‐ il ­‐17 purified antibody 36 anti jaggered 37 anti mouse hr 38 anti mousecd3 zeta chain 39 anti notch 40 anti ­‐cd3 41 apo i 42 auto bilirubin ( t&d ) 43 barbitone buffer 44 bd falcon 50 ml conical tube sterile, nonpyrogenic with screw cap 45 bd round polystyrene test tube 12x75mm, 5ml, 46 bdt sequencing, v3.1 cycle, 100 rections 47 bigdye terminator 48 bis ­‐acrylamide 49 b ­‐naphthyl acetate 50 boric acid 51 boric acid moleculargrade 52 brad ford reagent 53 brij ­‐23 54 bromophenol blue 55 bsa ( bovine serum albumin ) 56 bsa bovine serum albumin 57 bseji ( bsabi ) 58 bseji ( bsabi ) 2000units 59 bsl i 60 bsr i 61 bstn i 62 cac8i 63 calcium chloride 64 calcium green dye 65 capillaryarray, 96x50cm each 66 casein 67 casein 100g 68 ccr7 bv4214b12 69 cd11afitc m17 / 4 70 cd11bfitc m1 / 7071 cd ­‐19fitc 1d3 72 cd25pe pc61 73 cd28 74 cd28 human 75 cd29pe hm β1 ­‐1 76 cd3 human 77 cd34apc ram34 78 cd49dpe r1 2 79 cd81pe c15.6 80 cd8afitc 11b11 81 cd9biotin 53 ­‐6.7 82 cdna synthesis kit 83 cellculture plates sterile tissue culturetreated polystyrene, 12 ­‐well, flat ­‐bottom with lid 84 chaps ­‐ 85 charchol activated 86 charge lighter gas for burner 87 chemisol 88 chloramphenicol 89 chloramphenicol ­‐500gm 90 chloroamphenicol91 chloroform 92 chloroform mb grade 93 chloroform molecular grade 94 chloroquine diphosphate ­‐ salt 95 cholestrol 96 chymotrypsin 97 cloned amv rt 750u transcriptase 98 cocaltchoride 99 coenzyme a 100 colloidal stain 101 color change 0° labtop cooler for0.2 ml 102 commaric brilliant blue103 conjugated control igg 104 control igg 105 coomassie blue 106 coper sulphate 107 creatinine 108 cryo box rack 109 crystl violet110 culture flask 111 custom antibody services 112 cyclohexane 113 cytochrome c 114 dapt 115 dde i 116 ddntps ­‐dna sequencing chemical ( sanager based ) 117 dehydrin antibody 118 delta methrin 119 depc 120 depc treated water 121 depc water 122 dessicant 123 dialysis membrane 124 diethyl ether 125 diethyl ether500ml 126 diethyl pyrocarbonate 127 diethylamine ( cdh ) 128 disodium hydrogen ortho phosphate 129 disodium hydrogen phosphate dehydrate, 130 disodium sodium hydrogen phosphate 131 dithiobis 2 ­‐nitrobenzoic acid 132 dmso ( dimethylsulphoxide ) 133 dna ladder 134 dna ladder ­‐20bp, 50bp, 100bp, 1kb 135 dna polymerase 136 dna stabilizer 137 dnaase 138 dnase ­‐free rnase 139 dnasei 140 dnazol reagent 141 dneasy to remove dna contaminants 142 dntp mix 143 dntp mix 2.5 mm each 144 dntp mix, 10mm ( 2.5mm each ) 4x200μl 145 dntp mix ­‐10mm ( 2.5 mm each ) , 1000 μl 146 dntp mixture 147 dntps 148 dntps mix ( 2.5mm each ) 149 dntps mix ( 2.5mm each ) 150 dopamine 151 dpec 152 dpip153 dpn ii 154 dpx mountant for microscopy 155 dra i 156 drabkin reagents 157 dream taq 158 dream taq master mix ( genetix ) 159 dtt ( dithiothreitol ) 160 dtt ( di ­‐thiothrietol ) 161 eco rv 162 eco31i ( bsai ) 163 eco88i ( avai ) 164 eco88i ( avai ) 1000units 165 edta 166 edta ( ethylenediaminetetraacetate ) 167 edta 500g 168 edta molecular grade 169 edta vacutainer 170 edta, freeacid 171 emaraldamp max pcr master mix 172 eosin yellow 173 eosin yellowish stain ­‐ for microscopy 174 eosine yellowish merck 175 epoxomicin 176 etbr ­‐ready to use 177 ethanol 178 ethanol 500ml 179 ethanol anhydrous 180 ethanol molecular grade 181 ether 182 ether 500ml 183 ethidiumbromide 184 ethidium bromide molecular grade 185 ethyl alchol 186 ethyl ether 187 ethylene glycol ( egta ) 188 exonuclease 189 exonuclease i e.coli ­‐4000units190 exonuclease ­‐1 191 exosap ­‐it® for pcr ­‐product clean ­‐up ­‐ 200 ul 192 expansin antibody193 fast ap 194 fast blue b salt 195 fast ­‐media® amp xgal 196 fcs 197 fetal bovine serum ( fbs ) 198 ficollimmunohistochemistry: ultracruz mountingmedium 199 fitc labeled anti rabbit secondary igg antibody 200 fitc tagged antibodies 201 fok i 202 folic acid 203 forceps 204 formaldehyde 205 formaldehyde soln. 500ml 206 formic acid 207 foxp3 pe mf ­‐23 208 g6pddiagnosis kit 209 gamma secretase dapt210 geimsa stain 211 gene ruler 100 bp dna ladder 212 genecomptm 101 competent cells strain: dh5α, >1x108 213 generulertm 50 bp dna ladder ready ­‐ use 50μg 214 generuler™ 50bp dna ladder50μg 215 genomic dna isolation kit ( from filter paper ) 216 gentamicin antibioticsolution 217 gentamycin 218 giemsas stain sol 125mlmerck 219 glacial acetic acid 220 glacial aceticacid 500ml 221 glucose222 glucose 6 phosphate 223 glutathione 224 glutathione oxidised ( gssg ) 225 glutathione oxidized 226 glutathione reduced 227 glycerol 228 glycerol ( ar grade ) 229 glycerol anhydrous 2.5 ltremplura 230 glycine 231 glycogen 232 golgi stop 233 goodview dye 234 gr ­‐1pe 1a8 235 green taq pcr master mix 236 gtp 237 guanindine hydrochloride 238 h2o2 ( hydrogen peroxide ) 239 haeiii 240 hcl 241 hdl cholestrol 242 hema 3 system ( includes fixative and solutions i and ii ) 243 hepes 100ml 244 hepes buffer 245 hepes free acid 246 hes ­‐1 247 hi ­‐di formamide bottle ­‐25ml 248 high mol. wght marker 249 hydrochloric acid 250 hydrochloric acid 251 hydrochloric acid molecular grade 252 hydrochloric acid, 500ml 253 hyoxanthine 254 ifn ­‐g apc 255 il ­‐12fitc tc11 ­‐18h10 256 il ­‐17pe 257 il ­‐4purified 258 il ­‐6 259 il ­‐9purified d8402e8 260 imidazole 261 immersion oil 262 immersion oil ( microscopy grade ) 263 immidazole264 indicator tape forsteam autoclave265 insuline sringes 266 iodoacetamide ( iaa ) 267 ion exchange resins268 ipg strips 269 iptg ( isopropyl β ­‐d ­‐1 ­‐ thiogalactopyranoside ) 270 iso octane ( hplc gr ) 271 isoamyle alcohol272 isopropanol 273 isopropylalcohol 274 isopropyl alcohol ( hplc gr ) 275 isopropyl thiogalacto pyranoside 276 j.s.b. ­‐ stain solution no. ­‐1 277 j.s.b. ­‐ stain solution no. ­‐2 278 k2hpo4 279 kanamycin280 kappa hi ­‐fi hot start readymix 281 kappa hifi hotstart ready mix ­‐500rxn 282 kcl 283 kh2po4284 kmc8 285 kod plus 286 l ­‐ arginine 287 l glutamine 100x 100ml288 l ­‐arginine 289 lb agar290 lb agar 291 lb media 292 l ­‐canavaline 293 l ­‐citrulin 294 l ­‐glutathione reduced 295 lightcycler 296 l ­‐name 297 longamp taq dna polymerase ­‐ 500 units 298 low molecular weig. marker 299 lps 300 ls column 301 lysozyme302 lysozyme molecular grade 303 m ­‐30 d diluent 20 ltr 304 m ­‐30 e ­‐z cleanser 100ml x 1 305 m ­‐30 p probe cleanser 17ml x 1 306 m ­‐30 r ­‐rinse 20 ltr 307 magnaetic beads cd11c 308 magnaetic cd 4 309 magnaetic cd 8a 310 magnesium chloride 311 maximatm hot start pcr master mix 312 mboli 313 metaphor agarose ( dnase / rnase free ) for smallfragment separation ( <10bp ) 314 methanol 315 methanol ( hplc grade ) 316 methanol500ml 317 methnaol 318 methylene blue 319 methylene blue powder merck 320 methylene blue stain ­‐ for microscopy 321 methyline blue 322 mgcl2 323 micro tips200ul 324 micro tips 2ul 325 microamp fast reaction cap ( 8cap / strip ) 326 microampfast reaction tubes ( 8tubes / strip ) 327 microamp opticaladhesive film 328 microcrystalline cellulose 329 microtube tough spots 3 / 8 diameter 330 mineral oil331 mluc i 332 mnl i 333 molecular biology grade water 334 mono dansyl cadavarin 335 mouse cd ­‐27 v450 lg.3a10 336 mouse il ­‐10 pe jes5 ­‐16e3 mouse 337 murine ifn ­‐gamma 480 probes aster 338 mwo i 339 na2hpo4 340 nacl 341 nacl molecular grade, 342 nadp 343 neb 5 ­‐alpha f iq competent e.coli ( high efficiency ) ­‐ 6x0.2 ml 344 ngs / metagenomic / bioinformatic service 345 ni ­‐nta agarose beads 346 nitric acid 347 nitric oxide inhibitor : 1, 3 ­‐pbitu, dihydrobromide 348 nitroblue tetrazolium chloride 349 nitrocellulose membrane 350 nor noha 351 nuclease freewater 352 nuclease ­‐free water 1 liter 353 octopamine 354 o ­‐dianisidine 355 oligo ( primer ) 356 o ­‐phenylenediamine 357 optisafe gel hand gel 358 oregon green am 359 ortho phosphoric acid 360 para nitrophenyl acetate acetonitrile 361 parafilm 362 pbs 12x1l 363 pbs with tween ( pbs ­‐t ) 364 pcr marker mixture 365 pcr purification kit 366 pecoll367 penicillin streptomycin sol100ml 368 pepes 369 percoll 370 permethrin standard 371 ph strip 372 phenazonium methosulphate 373 phenol 374 phosphate ­‐buffer saline ( pbs ) 375 phosphoric acid 376 phusion hi ­‐fidelity taq polymerase 377 pms 378 pmsf 379 p ­‐naphthyl acetate 380 poneau dye 381 pop7 polymerfor 3730xldna analyzer 382 potacium dichromate 383 potasium acetate 384 potasium chloride 385 potasium nitrite386 potassium acid phosphate 387 potassium dichromate emplura 388 potassium dicromate 389 potassiumphosphate, monobasic 500g 390 pottasium dichromate 391 pottasium phosphate 392 powder free nitrile gloves ( small, medium, large ) 393 pre ­‐mixed green dye pcr master mix , 2x, 1000rxn 394 primer 395 primer 5000bp 396 propanol ­‐2 mb grade 397 propionic acid 250ml 398 propoxur pestanal ( 2 ­‐isopropoxy ­‐phenyl ) 399 propoxur, acetylthiocholine iodide 400 propyl alcohol ( ar, hplc ) 401 protease inhibitor cocktail 402 protease inhibitor cocktail tablet 403 protease inhibitors set 404 protein estimation kit 405 protein marker ( colored ) 406 protein molecular weight markers 407 proteinase k 408 proteomics ( itraq, lc ­‐ms, maldi ) services 409 pst 1 3000 units 410 pvdf membrane 411 pvdf membranes 412 rapamycin 413 rapigest 414 real ­‐time pcr master mix ( sybr ) ­‐200 x ul 415 recombinant proteins fgf416 recombinant proteins gmcsf417 recombinant proteins ifng 418 recombinant proteinsil ­‐10 419 recombinant proteins il ­‐12p40 420 recombinant proteins il ­‐1beta 421 recombinant proteins il ­‐21 422 recombinant proteins il ­‐4 423 restriction enzyme 424 restriction enzyme alui, pst i, sal i 425 reverse trancriptase 426 ribolock 427 ribozol rna extraction reagent 428 rna purification kit 429 rnalater 430 rnase inhibitor 431 rnase ­‐free dnase 432 rpmi 1640 1x10l 433 rpmi 1640 with hepes, l ­‐glutamine 434 rpmi ­‐1640 culture media with l ­‐ glutamine and 25mm hepes , without sodium bicarbonate 435 rsap 436 safeskin purple nitrile gloves ­‐9.5 inch length ( small ) 437 saponin 438 sca ­‐1fitc d7 439 sds 440 sephadex g ­‐75 441 serological pipettee 442 serotonin 443 sgot 444 sgpt 445 sheath fluid 446 sheathfluid 447 shirp alkaline phosphatase 448 shrimp alkaline phosphatase, recombnant ( rsap ) ­‐1000units ( 1u / ul ) 449 skimmed milk 450 skimmed milk 451 slide box 452 slide staining kit 453 sodium acetate 454 sodium acetate 455 sodium azide ­‐100gm 456 sodium bicarbonate 457 sodium carbonate 458 sodium chloride 459 sodium dihydrogen phosphate 460 sodium dithionate 461 sodium dodecyl sulphate 462 sodium hydrogen carbonate463 sodium hydroxide 464 sodium hydroxide molecular grade 465 sodiumhypochlorite 466 sodium hypochloriteemplura 467 sodium hypochlorite lr 468 sodium metavanadate 469 sodium nitrite 470 sodium phosphate ( dibasic ) 471 sodium phosphate ( monobasic ) 472 sodium phosphate, dibasic, anhydrous500g 473 sodium potasium tartarate 474 sodium succinate 475 sorbitol 476 spilfyter labsoakers477 sringe filter 0.45um478 sringes 10ml 479 sringes 1ml 480 sringes 50ml 481 ssii ( acii ) 482 ssii ( acii ) 200units 483 stat3 inhibitor 484 stepup100bp dna ladder, 100loads, 50μg 485 sterile h2o 486 sterile pbs 487 sterile te 488 streptavidin ­‐phycoerythrinfitc eat2 kmc8 489 streptomycin 490 streptomycin sulphate 491 sucrose 492 sulpho salicylic acid 493 sulphuric acid494 sulphuric acid ( commercial ) 495 syber green master mix 496 sybr green master mix ( roche ) 497 tag man probes / primer 498 taq dna polymerase 499 taq dna polymerase pfu ( for large fragment ) 500 taq dna polymerase with standard taq buffer ­‐2000 units 501 taq dnapolymerase ( 3u / μl ) 1000u 502 taqi 503 tca 504 tcrabapc h57 ­‐597 505 temed 506 temed ( tetramethylethylenediamine ) 507 terificbroth 508 tetra acetic acid 509 tetracycline, 50mg / ml, 20ml 510 tetramethylbenzidine 511 tgf ­‐beta 1 512 top taq master mix kit 513 toptaq dna polymerase 514 torin2 515 total protein 516 tough spots 517 triglycerides 518 tris 519 tris ( hydroxymethyl ) aminomethane 520 tris 500g 521 tris base 522 tris ( hydroxymethyl ) aminomethane 523 tris ­‐hcl molecular grade ( dnase / rnase free ) 524 triton x 100 525 trizol 526 trypan blue 527 trypsin proteomic grade 528 tween 20529 tyramine 530 universal methylated dna strand 531 urea 532 uric acid533 viral rna isolation kit 534 viral rt ­‐pcr kit 535 vsp i 536 water hplac grade 537 water hplc grade dnase / rnase free 538 xmn i 539 xylene ( gr grade ) 540 xylene gr 2.5 ltr541 β ­‐mercaptoethanol consumables= 1 cryo tags ( 30x19 ) 2 cryo tags ( 32.5x12.7 ) 3 forceps 4 freezingcardboard cryobox 5 hand ontm nitrile examination gloves6 hb microcuvatte 7 indicator bacillus strips for steam autoclave8 indicator tape for steam autoclave 9 k2edta vacutainer 10 lansets 11 medium safeskin nitrile gloves 12 nitrile gloves large 13 pricking needles 14 small safe skin nitrile gloves 15 tough spot 16 tough tags 17 whatman filter paper 18 whatman filter paper 3chr 19 whatmenn filter paper no. ( 12.5 cm ) glasswares = 1 beaker ( 25ml, 50 ml, 100ml, 250ml & 500ml ) / glassware 2 beakers ­‐100ml, 250ml, 500ml, 1000ml3 carboy with stopcock 4 conical flask ( 25ml, 50ml, 100ml, 250ml & 500ml ) / glassware 5 conical flask ­‐100ml, 250ml, 500ml, 1000ml 6 conical flasks 7 conical tubes ( 15 ml ) 8 conical tubes ( 50 ml ) 9 culture vials ( borosil ) 10 giemsa stain sol. 11 glass measuring cylinders ­‐ 25ml, 20ml, 100ml, 250ml, 500ml, 1000ml 12 glass slides 13 glass tubing ( borosil ) 14 glasswares 15 measuring cylinders16 micro slide 75 x 25mm. 1.1mm. froste d ( 50 / pack ) 17 micro slides 18 micro slides 75x25 mm ( thickness: 1.2mm ) 19 narrow mouth bottle, 1000ml 20 narrow mouth bottle, 500ml 21 reagent bottles 1000ml 22 reagent bottles 500ml 23 round bottom flask, 100ml, 250ml, 500 ml, 1000ml, 2000, 3000 ml 24 schott duran bottles ­‐ 50ml, 100ml, 250ml, 500ml, 1000ml 25 stirring rod 26 test tube 27 test tubes ­‐2ml ­‐10ml 28 wide mouth bottle, 1000ml 29 wide mouth bottle, 500ml list of kits= 1 mouse 10 ­‐plex for cytkine detection: il1b, il4, il6, il10, il12p 40 , tnf a, il17, ifn g, mip1, il2 2 ni ­‐ntaspin columns 3 2d starter kit 4 7 ­‐aminoactinomycin d ( 7 ­‐a 1 mg. 5 agencourt ampure xp kit 6 arginase detedtin kit 7 axyprep blood genomic dna miniprep kit 8 buffer kit 9 cdna synthesis kit 10 dengue ns1 ag + igg / igm kit 11 dna blood mini kit ( 250 ) 12 dna isloation kit from animal tissues, whole blood, dried blood spot, 250 rxns 13 dna isolation kit 14 dnase 1000 units 15 dreamtaq dna polymerase 500 units 16 dynabeads mrna direct micro kit 17 e ­‐gelsize select 2% 18 elisa kit19 falcivax kit 20 falcivax pf / pv rdt kit 21 flacivax divice 22 g6pd kit 23 g6pd kit span diagnostic 24 g6pd testkit 25 gel extraction kit ­‐250rxns 26 gel purification kits 27 genejet gel extraction kit, 250 prep 28 genejet pcr purification kit 29 genejet whole blod genomic dnapurification 30 genescan ­‐500 ( liz ) size std kit ea 31 gst resins 32 high sensitivity dna kit for bioanalyzer 33 human10 ­‐plex for cytkine detection: il1b, il4, il6, il10, il12p 40 , tnf a, il17, ifn g, mip1, il2 34 il12, il10, tnf ­‐alpa, ifn ­‐gamma elisa kits 35 ion 314 chip kit v2 each 36 ion 316 chip kit v2 ( 4 pack ) each 37 ion 318chipkit ( 4 pack ) each 38 ion pgm enrichment beads each 39 ion pgm sequencing 400 kit each 40 ion pgm template ot2 400 kit each 41 ion sphere quality control kit each 42 ion torrent 1 ­‐16 barcode kit 43 ion torrent dna standard & primer premix kit 44 ion torrent rna library preparationkit 45 ion total rna –seq kit 46 itaq sybrgreensupermix 47 malaria diagnosis kit 48 maxima sybr green qpcrmaster mix, 200 reacts 49 mtt cell proliferation kit50 nebnext fastdna fragmentation and library ­‐prep set for ion torrent ­‐ 50 rxns 51 notch receptor interaction antibody sampler kit 52 parachek divice 53 pcr cloning kit 54 pcr purification kit, 250rxns 55 pgem t easy vector system 56phospho ­‐akt pathway antibody sampler kit 57 pierce gst protein interactionpull downkit, 25rxn 58 piercehis protein interaction pull down kit, 25rxn 59 plasmid dna isolation kits 60 platinum pcr supermix high fi 100 reactions 61 prostaglandin e2 parameter assay kit 62 protein digetion kit ( in gel ) 63 q pcr kit 64 qiaamp dna blood mini kit ( 250 ) 65 qiaamp dna mini kit, 250prep 66 qiaamp viral rna mini kit 67 qiagen one step rt ­‐pcr kit68 qiaquick pcr purification kit 69 qiaquick pcr purification kit ( 250 ) 70 quibet quantification kit 71 quick start protein assay kit 72 real time pcr kit 73 revertaid premium first strand cdnasynthesis kit, 50 reacts 74 rna in ­‐situ hybridization kit 75 rnaisolation kit 76 rna purification kit 77 silver stain kit 78 smarter cdna synthesis kit 79 sybr fast qpcr kit 80 taq dna polymerase 3u / ul 81 tgfb single plex 82 transcript aid t7 high yield transcription kit 83 urea detection kits 84 whole blood dna isolationkit 85 whole genome amplification kit 86 kinore ­‐glo adp ­‐glo kinore assay kit plasticwares 1 0.2 micron syringe filters 2 0.2ml 96 well plates 3 0.2ml pcr 8 ­‐strip tubes with attached domed caps, 4 0.2ml pcr tube with domed cap 5 0.2ml pcr tube with flat cap, 1000 / pk 6 0.2ml pcr tubes 7 0.2mlpcr tubes, flat cap 8 0.2ml pcr tubes, strips 9 0.45 micron syringe filters10 0.5ml micro centrifuge tube 11 0.5ml micro tube box 12 0.5ml, 0.6ml low retention tubes with cap 13 0.6ul microtubes 14 1 ml pipette tips 15 1.5 ml eppendorf tubes 16 1.5ml micro ambertube 17 1.5ml micro centrifuge tube 18 1.5ml micro tube box 19 1.6ml graduated, mct 20 10 ul pipette tips 21 10μl bulk tip 22 10μlfilter tip 23 1000 ul tips 24 1000ul barrier micro tips 25 1000ulfilter tips 26 100ul barrier micro tips 27 100ulbarrier micro tips, filtered, sterile, low 28 10ul barrier micro tips, filtered, sterile, low 29 1250ul barrier micro tips, filtered, sterile, low retention, 30 15 ml falcon tubes 31 15ml polypropylene conical centrifuge tube, 32 2 ml eppendorf tubes 33 200 μl bulk tip 34 200 μl filter tip 35 200 μlmicro tips 36 200 ­‐1000μl micro tips 37 200ulbarrier micro tips 38 200ul barrier micro tips, filtered, sterile, low 39 200ul pipette tips 40 200ul tips 41 50 ml flacon tubes 42 5 ­‐10 ul tips 43 5 ­‐10μl micro tips 44 96 well plates flat ­‐bottom with lid 45 aerosol barrier universaltips, 0.5 ­‐10μl 46 aerosol barrier universaltips, 100 ­‐1000μl 47 aerosol barrier universaltips, 1 ­‐200μl 48 amber centrifuge tube conical bottom ( 15ml ) 49 ambercentrifuge tube conical bottom ( 50ml ) 50 amberwide mouthbottle 500ml ( 6 pack ) 51 autoclave bags 52 bd falcon 50ml conical tube sterile, nonpyrogenic with screw cap 53 bdround polystyrene test tube 12x75mm, 5ml, 54 beaker 500ml tpx ( 6 / pack ) 55 beaker ­‐100ml, 250ml, 500ml, 1000ml 56 blood clooection tubessterile vaccum edta 13x75mm, 3ml ( bd ) 57 blood clooection tubes sterile vaccum vacutainer slica clot13x75mm, 4ml ( bd ) 58 brown dark colour 1.5 ­‐2.0 mlmct 59 card board cryobox81place box for 1ml / 2ml vials ( 10 / pack ) 60 cardboard cryobox 61 cardboard cryobox ­‐100 place box for 1.0 ­‐ 2ml 62 cell culture plates sterile tissue culture treated polystyrene, 12 ­‐well, flat ­‐bottom with lid 63 cell culture plates sterile tissue culture treated polystyrene, 6 ­‐well, flat ­‐bottom with lid 64 centifuge tube 15 ml 65 centifuge tube 50 ml 66 centifuge tube, conical bottom, 15ml 67 centifuge tube, conical bottom, 50ml 68 centricons for protein concentration 69 centrifuge tube17 x 120mm, 15 ml 70 centrifuge tube conticla bottom 15ml pp sterile ( 500 / pack ) 71 centrifuge tubes 2 ml72 centrifuge vials 73 conical centrifuge tube, pp / hdpe, 15ml, 74 conical flask 1000ml 75 conical flask 250ml 76 conical flask ­‐100ml, 250ml, 500ml, 1000ml 77 conical tube rack 78 conical tubes ( 15 ml ) 79 conical tubes ( 50 ml ) 80 cryo box 81 cryo box 1.0 & 1.8ml 81 places ( 4 / pack ) 82 cryo box rack 83 cryo spots for tubes labelling 84 cryo vials 1.2 ml ( internal thread ) 85 cryovials sterile 1.8ml ( 500 / pack ) 86 cryotags ­‐1.28x0.50 87 cryovial sterile threaded ( 1.0ml ) 88 cryovial, 0.5ml, natural, pp, sterile, bulk, 89 culture flask ( 25cc sterile; non vented; closed cap ) 90 culture flask ( 25cc sterile; vented ) 91 culture flask ( 75cc sterile;non vented; closed cap ) 92 culture petri plates ( sterile ) 93 disposable basins 94 disposable filters 1 ltr 95 disposable filters 250 ml 96 eco illumina 48well plates ( real time plate ) 97 elisa plates 98 eppendorf tube ­‐1.5ml 99 eppendorf ( 1.5ml ) 100 eppendorf stands101 eppendorf tubes ( 1.5ml, 2 ml ) 102 falcons 15 ml 103 filterdiscs 104 filter tips 105 filters .22um 106 forcep 107 freezer change rack for 1.5 ­‐2ml tubes96 places, 44x99x141 108 frosted slide 109 funnel110 gloves ( nitrile ) powder free 111 gloves rack 112 glucose 201 microcuvettes ( 4x25 ) 113 hand ontm nitrile examination gloves 114 indicator tape for steam autoclave 115 insuline sringes 116 internal thread 117 isofreeze pcr rack 118 lightcycler® 480 multiwell plate 96, white 119 lightcycler® 480 multiwell plate 96white with sealing 120 lightcycler480 multiwell plate 121 magnetic beads for stirrerwith its magnetic rod 122 magnetic stand for 1.5 ­‐2ml tubes 123 maxymium recovery tips, bulk 0.5 ­‐10μl 124 maxymium recovery tips, bulk 100 ­‐ 1000μl 125 maxymium recovery tips, bulk 1 ­‐200μl 126 measuring cylinder ( 25ml, 50 ml, 100ml, 250ml &500ml ) / glassware 127 measuring scoop ( 100 ) 128 measuring scoop ( 5 ) 129 measuring scoop ( 50 ) 130 membrane filter holder ­‐47mm 131 micro centrifuge tube 0.5ml 132 micro centrifuge tube 1.5ml 133 micro centrifuge tube 1.5ml 134 micro centrifuge tube 2.0ml 135 micro centrifuge tube, amber colour, 0.5ml136 micro centrifuge tube, amber colour, 1.5ml 137 micro centrifuge tube, amber colour, 2ml 138 micro cetrifuge tube 1.5ml ( 500 / pack ) 139 micro pipette box ( small & large ) 140 micro pipette tips 1000 μl 500 no 141 microtest plate142 micro tip ( 0.2 ­‐10microlitre ) 143 micro tip ( 10 ­‐200microlitre ) 144 micro tips 1000ul 145 micro tips 200ul 146 micro tips2ul 147 micro tube box, 1.5ml 148 microamp® enduraplate™ optical 96 ­‐wellfast clear reaction plates with barcode 149 microamp® enduraplate™ optical 96 ­‐well fast clear reaction plates with barcode 150 microamp®fast 8 ­‐tube strip, 0.1 ml 151 microamp® fast reaction tube with cap, 0.1 ml 152 micro ­‐capillary tubes 153 micropestle 154 microtips .1 ­‐10ul 155 microtips 100 ­‐1000ul 156 microtips 2 ­‐200ul 157 microtube tough spots 158 midi sub prep system ­‐size 13cmx 25cm 159 mini kit, 50prep 160 minisart nylon0.45 ul 25 mm 161 multipurpose labelingtape ( mixed ) 162 narrow mouth bottle, 1000ml 163 narrow mouth bottle, 500ml 164 non filter microtips ( 1000 ul ) 165 non filter microtips ( 200 ul ) 166 non skirted 96 well plate standard 167 non ­‐filtermicrotips ( 10 ul ) 168 non ­‐filter microtips ( 100ul ) 169 oak ridge centrifuge tube 10ml pp ( pack of 24x12 piece ) 170 parafilm 171 parafilm dispenser172 parafilm, 4x125, 1pk 173 parafilm, 4x250, 1 pk 174 pasteur pipette ( 1ml sterile ) 175 pasteur pipette rubber bulb 176 pasture pipette 1mlstrile ( 500 / pack ) 177 pasture pipette 3mlstrile ( 500 / pack ) 178 pcr 0.2ml tuberack with cover 179 pcr plates 180 pcr tube racks 181 pcrtubes 182 pcr tubes 183 pcr tubes & caps, rnase ­‐free, 0.2 ml ( 8 stript formate ) 184 pcr tubes ( acer + thermo cycler ) 185 pcr tubes caps 186 pcr tubes ( 0.2mlflat cap tubes ) 187 pd 10 empty gravity flow columns 188 petridishes 189 petridishes ­‐90mm 190 pipette mates 191 pipette stands 192 plastic beaker 193 plasticware ( tips&tubes 194 powder free nitrile exam gloves ­‐ small, medium, large size 195 pricking needle 196 rack for microtube, 0.5ml x24 197 rack for microtube, 1.5ml x24 198 rack for microtube, 1.5ml x48 199 racked ­‐96, 768 / pk 200 radiation sterilized falcon ( 15ml, 50ml ) 201 reagent bottles 1000ml 202 reagent bottles 500ml203 reagent reservoir ­‐25ml 204 recombinant proteins ifng 205 retention, racked ­‐96, 960 / pk, low retention tips 206 reversible racks ­‐96 places, 12x8 array 207 safeskin purple nitrile gloves medium ( 100 / pack ) 208 scissors 209 serological pipette sterile ( 2ml, 5ml, 10ml ) 210 serological pipettee 211 serological pipettes ( 10ml ) 212 serologicalpipettes ( 1ml ) 213 serological pipettes ( 2ml ) 214 serological pipettes ( 5ml ) 215 sheath fluid 216 slide box 217 slide staining kit 218 spilfyterlabsoakers 219 storage boxes for eppendorf tubes 220 storage vials 2ml 221 storage vials 5 ml 222 supreno se, nitrile , powder free , small, 100 pc / bx 223 syringe filter 224 syringe filters ­‐ 0.2 ­‐0.45um size 225 syringes 226 syringes 10 ml 227 syringes 1ml 228 syringes 50 ml 229 syringes ­‐5 ­‐10ml 230 tc flask 25 cm2 ( with doubel sealcap ) 231 tcflask 75 cm2 ( with doubel seal cap ) 232 testtubes ­‐2ml ­‐10ml 233 thermal paper 234 thin ­‐walled, frosted lid, rnase ­‐free pcr tubes ( 0.2 ml ) 235 thin ­‐walled, frosted lid, rnase ­‐freepcr tubes ( 0.2 ml ) 236 tips 0.5 ­‐ 10 ul 237 tips100 ­‐1000 ul 238 tips 1 ­‐200 ul ul 239 toughspots 240 tubes & caps, 50 / bg 241 tubes standfor 15ml ­‐ 50ml falcontubes 242 utility tray ­‐360x310x130 mm243 vaccutainer ( heparinized ) 244 vacutainer ( edta coated ) 245 vacuum ­‐driven filters mcehydrophilic membrane ­‐pore size 0.22 mm, 250 ml volume, 12no / pack 246 wide mouth bottle, 1000ml 247 wide mouth bottle, 500ml list of sequencing for 2016 ­‐17 s.no. sequencing 1 genome sequencing, transcritome sequencing: illumina / roche / pac bio services 2 sequencing 3 standard single ( pcr ) sequncing 4 standard ­‐seq plate ( multi primer ) 5 i ­‐d 6 2 ­‐de 7 in solution digestion 8 in gel digestion 9 lc ­‐ms / ms 10 maldi ­‐tof 11 itraq 12 tmt...